Morpholino
MO2-bmp7a
- ID
- ZDB-MRPHLNO-050902-3
- Name
- MO2-bmp7a
- Previous Names
-
- MO2-bmp7 (1)
- Target
- Sequence
-
5' - CCAATCCAGAGCAACATCCAGCATG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-bmp7a
No data available
Phenotype
Phenotype resulting from MO2-bmp7a
| Phenotype | Fish | Figures |
|---|---|---|
| epidermal cell fate specification disrupted, abnormal | AB + MO2-bmp7a |
Fig. 8 
from Hsiao et al., 2007 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-bmp7a
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| epidermal cell fate specification disrupted, abnormal | AB + MO2-bmp7a | standard conditions |
Fig. 8
from Hsiao et al., 2007 |
1 - 1 of 1
Citations
- Sun, Y., Tseng, W.C., Fan, X., Ball, R., and Dougan, S.T. (2014) Extraembryonic signals under the control of MGA, Max, and Smad4 are required for dorsoventral patterning. Developmental Cell. 28(3):322-334
- Hsiao, C.D., You, M.S., Guh, Y.J., Ma, M., Jiang, Y.J., and Hwang, P.P. (2007) A Positive Regulatory Loop between foxi3a and foxi3b Is Essential for Specification and Differentiation of Zebrafish Epidermal Ionocytes. PLoS One. 2(1):e302
- Hogan, B.M., Layton, J.E., Pyati, U.J., Nutt, S.L., Hayman, J.W., Varma, S., Heath, J.K., Kimelman, D., and Lieschke, G.J. (2006) Specification of the Primitive Myeloid Precursor Pool Requires Signaling through Alk8 in Zebrafish. Current biology : CB. 16(5):506-511
- Holzschuh, J., Wada, N., Wada, C., Schaffer, A., Javidan, Y., Tallafuss, A., Bally-Cuif, L., and Schilling, T.F. (2005) Requirements for endoderm and BMP signaling in sensory neurogenesis in zebrafish. Development (Cambridge, England). 132(16):3731-3742
- Imai,Y. and Talbot, W.S. (2001) Morpholino phenocopies of the bmp2b/swirl and bmp7/snailhouse mutations. Genesis (New York, N.Y. : 2000). 30(3):160-163
1 - 5 of 5
Show