Morpholino
MO6-cdh1
- ID
- ZDB-MRPHLNO-050826-2
- Name
- MO6-cdh1
- Previous Names
-
- chd1MO (1)
- Target
- Sequence
-
5' - AAAGTCTTACCTGAAAAAGAAAAAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Splice blocker morpholino.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-cdh1
No data available
Phenotype
Phenotype resulting from MO6-cdh1
1 - 5 of 5
Phenotype of all Fish created by or utilizing MO6-cdh1
1 - 5 of 7 Show all
Citations
- Akieda, Y., Ogamino, S., Furuie, H., Ishitani, S., Akiyoshi, R., Nogami, J., Masuda, T., Shimizu, N., Ohkawa, Y., Ishitani, T. (2019) Cell competition corrects noisy Wnt morphogen gradients to achieve robust patterning in the zebrafish embryo. Nature communications. 10:4710
- Poulton, L.D., Nolan, K.F., Anastasaki, C., Waldmann, H., and Patton, E.E. (2010) A novel role for Glucocorticoid-Induced TNF Receptor Ligand (Gitrl) in early embryonic zebrafish development. The International journal of developmental biology. 54(5):815-825
- Mich, J.K., Blaser, H., Thomas, N.A., Firestone, A.J., Yelon, D., Raz, E., and Chen, J.K. (2009) Germ cell migration in zebrafish is cyclopamine-sensitive but Smoothened-independent. Developmental Biology. 328(2):342-354
- Shimizu, T., Yabe, T., Muraoka, O., Yonemura, S., Aramaki, S., Hatta, K., Bae, Y.K., Nojima, H., and Hibi, M. (2005) E-cadherin is required for gastrulation cell movements in zebrafish. Mechanisms of Development. 122(6):747-763
1 - 4 of 4
Show