Morpholino
MO1-lmx1bb
- ID
- ZDB-MRPHLNO-050824-3
- Name
- MO1-lmx1bb
- Previous Names
-
- lmx1b.1-ATG (1)
- MO1-lmx1b.1
- Target
- Sequence
-
5' - CTTCGATTTTTATACCGTCCAACAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-lmx1bb
No data available
Phenotype
Phenotype resulting from MO1-lmx1bb
1 - 5 of 8 Show all
Phenotype of all Fish created by or utilizing MO1-lmx1bb
1 - 5 of 38 Show all
Citations
- Wang, F., Ren, D., Liang, X., Ke, S., Zhang, B., Hu, B., Song, X., Wang, X. (2019) A long noncoding RNA cluster-based genomic locus maintains proper development and visual function. Nucleic acids research. 47(12):6315-6329
- He, B., Ebarasi, L., Zhao, Z., Guo, J., Ojala, J.R., Hultenby, K., De Val, S., Betsholtz, C., Tryggvason, K. (2014) Lmx1b and FoxC Combinatorially Regulate Podocin Expression in Podocytes. Journal of the American Society of Nephrology : JASN. 25(12):2764-77
- Burghardt, T., Kastner, J., Suleiman, H., Rivera-Milla, E., Stepanova, N., Lottaz, C., Kubitza, M., Böger, C.A., Schmidt, S., Gorski, M., de Vries, U., Schmidt, H., Hertting, I., Kopp, J., Rascle, A., Moser, M., Heid, I.M., Warth, R., Spang, R., Wegener, J., Mierke, C.T., Englert, C., and Witzgall, R. (2013) LMX1B is Essential for the Maintenance of Differentiated Podocytes in Adult Kidneys. Journal of the American Society of Nephrology : JASN. 24(11):1830-48
- Katherine, B.V., Roger, L.B., and Rodríguez, R.E. (2013) Cocaine modulates the expression of transcription factors related to the dopaminergic system in zebrafish. Neuroscience. 231:258-271
- McMahon, C., Gestri, G., Wilson, S.W., and Link, B.A. (2009) Lmx1b is essential for survival of periocular mesenchymal cells and influences Fgf-mediated retinal patterning in zebrafish. Developmental Biology. 332(2):287-298
- Elsen, G.E., Choi, L.Y., Millen, K.J., Grinblat, Y., and Prince, V.E. (2008) Zic1 and Zic4 regulate zebrafish roof plate specification and hindbrain ventricle morphogenesis. Developmental Biology. 314(2):376-392
- Filippi, A., Duerr, K., Ryu, S., Willaredt, M., Holzschuh, J., and Driever, W. (2007) Expression and function of nr4a2, lmx1b, and pitx3 in zebrafish dopaminergic and noradrenergic neuronal development. BMC Developmental Biology. 7(1):135
- O'Hara, F.P., Beck, E., Barr, L.K., Wong, L.L., Kessler, D.S., and Riddle, R.D. (2005) Zebrafish Lmx1b.1 and Lmx1b.2 are required for maintenance of the isthmic organizer. Development (Cambridge, England). 132(14):3163-3173
1 - 8 of 8
Show