Morpholino

MO1-dnmt3bb.1

ID
ZDB-MRPHLNO-050809-6
Name
MO1-dnmt3bb.1
Previous Names
  • dnmt4-MO
Target
Sequence
5' - TTATTTCTTCCTTCCTCATCCTGTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-dnmt3bb.1
No data available
Phenotype
Phenotype resulting from MO1-dnmt3bb.1
Phenotype Fish Figures
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 Fig. 2 from Wang et al., 2017
determination of liver left/right asymmetry disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 Fig. 2 from Wang et al., 2017
determination of pancreatic left/right asymmetry disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 Fig. 2 from Wang et al., 2017
forerunner cell group cdh1 expression decreased amount, abnormal s870Tg + MO1-dnmt3bb.1 Fig. 6 from Wang et al., 2017
forerunner cell group distributed, abnormal s870Tg + MO1-dnmt3bb.1 Fig. 6 from Wang et al., 2017
forerunner cell group sox17 expression spatial pattern, abnormal WT + MO1-dnmt3bb.1 Fig. 6 from Wang et al., 2017
forerunner cell group foxj1a expression spatial pattern, abnormal WT + MO1-dnmt3bb.1 Fig. 6 from Wang et al., 2017
forerunner cell group actin filament structure, abnormal s870Tg + MO1-dnmt3bb.1 Fig. 6 from Wang et al., 2017
forerunner cell group DNA-methyltransferase activity decreased occurrence, abnormal s870Tg + MO1-dnmt3bb.1 Figure 10 from Fillatre et al., 2019
forerunner cell group nucleus ab1-5-mc labeling decreased amount, abnormal s870Tg + MO1-dnmt3bb.1 Figure 10 from Fillatre et al., 2019
heart jogging disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 Fig. 2 from Wang et al., 2017
heart looping process quality, abnormal twu34Tg + MO1-dnmt3bb.1 Fig. 2,  Fig. 6 from Wang et al., 2017
heart tube position, abnormal twu34Tg + MO1-dnmt3bb.1 Fig. 2,  Fig. 6 from Wang et al., 2017
liver position, abnormal twu34Tg + MO1-dnmt3bb.1 Fig. 2 from Wang et al., 2017
pancreatic bud position, abnormal twu34Tg + MO1-dnmt3bb.1 Fig. 2 from Wang et al., 2017
Phenotype of all Fish created by or utilizing MO1-dnmt3bb.1
Phenotype Fish Conditions Figures
determination of heart left/right asymmetry disrupted, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
forerunner cell group decreased amount, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
forerunner cell group apoptotic process increased occurrence, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
Kupffer's vesicle decreased size, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
heart jogging process quality, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
Kupffer's vesicle motile cilium decreased length, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
forerunner cell group cell population proliferation decreased occurrence, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
heart tube mislocalised, abnormal AB/TU + MO1-dnmt3bb.1 + MO2-dnmt3bb.1 standard conditions Figure 9 from Fillatre et al., 2019
forerunner cell group sox17 expression spatial pattern, abnormal WT + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
forerunner cell group distributed, abnormal WT + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
forerunner cell group foxj1a expression spatial pattern, abnormal WT + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
heart tube position, abnormal WT + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
heart looping process quality, abnormal WT + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
forerunner cell group distributed, abnormal s870Tg + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
forerunner cell group nucleus ab1-5-mc labeling decreased amount, abnormal s870Tg + MO1-dnmt3bb.1 standard conditions Figure 10 from Fillatre et al., 2019
forerunner cell group actin filament structure, abnormal s870Tg + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
forerunner cell group cdh1 expression decreased amount, abnormal s870Tg + MO1-dnmt3bb.1 standard conditions Fig. 6 from Wang et al., 2017
forerunner cell group DNA-methyltransferase activity decreased occurrence, abnormal s870Tg + MO1-dnmt3bb.1 standard conditions Figure 10 from Fillatre et al., 2019
heart tube position, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
heart looping process quality, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
pancreatic bud position, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
determination of pancreatic left/right asymmetry disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
heart jogging disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
determination of liver left/right asymmetry disrupted, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
liver position, abnormal twu34Tg + MO1-dnmt3bb.1 standard conditions Fig. 2 from Wang et al., 2017
heart looping process quality, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
determination of heart left/right asymmetry disrupted, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
heart jogging disrupted, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
heart tube position, exacerbated twu34Tg + MO1-dnmt3bb.1 + MO4-dnmt1 standard conditions Fig. 2 from Wang et al., 2017
Citations