Morpholino
MO1-itga5
- ID
- ZDB-MRPHLNO-050620-1
- Name
- MO1-itga5
- Previous Names
- None
- Target
- Sequence
-
5' - TAACCGATGTATCAAAATCCACTGC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
A translation blocking morpholino designed to bind the 5' UTR just upstream of the start codon.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-itga5
No data available
Phenotype
Phenotype resulting from MO1-itga5
No data available
Phenotype of all Fish created by or utilizing MO1-itga5
from 1 - 3 of 3
Citations
- Hipke, K., Pitter, B., Hruscha, A., van Bebber, F., Modic, M., Bansal, V., Lewandowski, S.A., Orozco, D., Edbauer, D., Bonn, S., Haass, C., Pohl, U., Montanez, E., Schmid, B. (2023) Loss of TDP-43 causes ectopic endothelial sprouting and migration defects through increased fibronectin, vcam 1 and integrin α4/β1. Frontiers in cell and developmental biology. 11:11699621169962
- Naganathan, S.R., Popović, M., Oates, A.C. (2022) Left-right symmetry of zebrafish embryos requires somite surface tension. Nature. 605(7910):516-521
- Jülich, D., Cobb, G., Melo, A.M., McMillen, P., Lawton, A.K., Mochrie, S.G., Rhoades, E., Holley, S.A. (2015) Cross-Scale Integrin Regulation Organizes ECM and Tissue Topology. Developmental Cell. 34(1):33-44
- Dray, N., Lawton, A., Nandi, A., Jülich, D., Emonet, T., and Holley, S.A. (2013) Cell-Fibronectin Interactions Propel Vertebrate Trunk Elongation via Tissue Mechanics. Current biology : CB. 23(14):1335-41
- Bhat, N., and Riley, B.B. (2011) Integrin-α5 Coordinates Assembly of Posterior Cranial Placodes in Zebrafish and Enhances Fgf-Dependent Regulation of Otic/Epibranchial Cells. PLoS One. 6(12):e27778
- Jülich, D., Mould, A.P., Koper, E., and Holley, S.A. (2009) Control of extracellular matrix assembly along tissue boundaries via Integrin and Eph/Ephrin signaling. Development (Cambridge, England). 136(17):2913-2921
- Jülich, D., Geisler, R., Tübingen 2000 Screen Consortium, and Holley, S.A. (2005) Integrinalpha5 and Delta/Notch Signaling Have Complementary Spatiotemporal Requirements during Zebrafish Somitogenesis. Developmental Cell. 8(4):575-586
1 - 7 of 7
Show