Morpholino
MO1-nfe2l2a
- ID
- ZDB-MRPHLNO-050603-1
- Name
- MO1-nfe2l2a
- Previous Names
-
- MO1-nfe2l2
- Target
- Sequence
-
5' - CATTTCAATCTCCATCATGTCTCAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
Morpholino sequence provided by authors.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-nfe2l2a
No data available
Phenotype
Phenotype resulting from MO1-nfe2l2a
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-nfe2l2a
1 - 5 of 21 Show all
Citations
- Abate, G., Pezzotta, A., Pucci, M., Bortolotto, V., Ribaudo, G., Bonini, S.A., Mastinu, A., Maccarinelli, G., Ongaro, A., Tirelli, E., Zizioli, D., Gianoncelli, A., Memo, M., Grilli, M., Uberti, D. (2024) The Bioactive Gamma-Oryzanol from Oryza sativa L. Promotes Neuronal Differentiation in Different In Vitro and In Vivo Models. Antioxidants (Basel, Switzerland). 13(8):
- Chang, S.H., Giong, H.K., Kim, D.Y., Kim, S., Oh, S., Yun, U.J., Lee, J.S., Park, K.W. (2023) Activation of Nrf2 by sulfuretin stimulates chondrocyte differentiation and increases bone lengths in zebrafish. BMB reports. 56:496501496-501
- Van Hall-Beauvais, A., Poganik, J.R., Huang, K.T., Parvez, S., Zhao, Y., Lin, H.Y., Liu, X., Long, M.J.C., Aye, Y. (2022) Z-REX uncovers a bifurcation in function of Keap1 paralogs. eLIFE. 11:
- Guan, R., Wen, X.Y., Leung, C.H., Ciano-Oliveira, C.D., Lam, S., Dai, S.Y., Karbassi, F., Mauro, A., Wang, Y., Rotstein, O. (2021) Plasma obtained following murine hindlimb ischemic conditioning protects against oxidative stress in zebrafish models through activation of nrf2a and downregulation of duox. PLoS One. 16:e0260442
- Sant, K.E., Moreau, H.M., Williams, L.M., Jacobs, H.M., Bowsher, A.M., Boisvert, J.D., Smolowitz, R.M., Pantazis, J., Annunziato, K., Nguyen, M., Timme-Laragy, A. (2020) Embryonic exposures to mono-2-ethylhexyl phthalate induce larval steatosis in zebrafish independent of Nrf2a signaling. Journal of developmental origins of health and disease. 12(1):132-140
- Li, H., Zhang, Q., Li, W., Li, H., Bao, J., Yang, C., Wang, A., Wei, J., Chen, S., Jin, H. (2019) Role of Nrf2 in the antioxidation and oxidative stress induced developmental toxicity of honokiol in zebrafish. Toxicology and applied pharmacology. 373:48-61
- Poganik, J.R., Long, M.J.C., Disare, M.T., Liu, X., Chang, S.H., Hla, T., Aye, Y. (2019) Post-transcriptional regulation of Nrf2-mRNA by the mRNA-binding proteins HuR and AUF1. FASEB journal : official publication of the Federation of American Societies for Experimental Biology. 33(12):14636-14652
- Mukaigasa, K., Tsujita, T., Nguyen, V.T., Li, L., Yagi, H., Fuse, Y., Nakajima-Takagi, Y., Kato, K., Yamamoto, M., Kobayashi, M. (2018) Nrf2 activation attenuates genetic endoplasmic reticulum stress induced by a mutation in the phosphomannomutase 2 gene in zebrafish. Proceedings of the National Academy of Sciences of the United States of America. 115(11):2758-2763
- Holowiecki, A., O'Shields, B., Jenny, M.J. (2017) Spatiotemporal expression and transcriptional regulation of heme oxygenase and biliverdin reductase genes in zebrafish (Danio rerio) suggest novel roles during early developmental periods of heightened oxidative stress. Comparative biochemistry and physiology. Toxicology & pharmacology : CBP. 191:138-151
- Sant, K.E., Hansen, J.M., Williams, L.M., Tran, N.L., Goldstone, J.V., Stegeman, J.J., Hahn, M.E., Timme-Laragy, A. (2017) The role of Nrf1 and Nrf2 in the regulation of glutathione and redox dynamics in the developing zebrafish embryo. Redox Biology. 13:207-218
1 - 10 of 26
Show