Morpholino
MO6-neurog1
- ID
- ZDB-MRPHLNO-050524-1
- Name
- MO6-neurog1
- Previous Names
-
- ngn-1MO (1)
- Target
- Sequence
-
5' - CGATCTCCATTGTTGATAACCTTA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino targeting the neurog1 gene.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO6-neurog1
No data available
Phenotype
Phenotype resulting from MO6-neurog1
No data available
Phenotype of all Fish created by or utilizing MO6-neurog1
| Phenotype | Fish | Conditions | Figures |
|---|---|---|---|
| axon regeneration disrupted, abnormal | WT + MO6-neurog1 | ablation: axon: trigeminal ganglion |
Fig. 4 
from O'Brien et al., 2009 |
1 - 1 of 1
Citations
- O'Brien, G.S., Martin, S.M., Söllner, C., Wright, G.J., Becker, C.G., Portera-Cailliau, C., and Sagasti, A. (2009) Developmentally Regulated Impediments to Skin Reinnervation by Injured Peripheral Sensory Axon Terminals. Current biology : CB. 19(24):2086-2090
- Caron, S.J., Prober, D., Choy, M., and Schier, A.F. (2008) In vivo birthdating by BAPTISM reveals that trigeminal sensory neuron diversity depends on early neurogenesis. Development (Cambridge, England). 135(19):3259-3269
- Knaut, H., Blader, P., Strähle, U., and Schier, A.F. (2005) Assembly of trigeminal sensory Ganglia by chemokine signaling. Neuron. 47(5):653-666
- Sagasti, A., Guido, M.R., Raible, D.W., and Schier, A.F. (2005) Repulsive interactions shape the morphologies and functional arrangement of zebrafish peripheral sensory arbors. Current biology : CB. 15(9):804-814
1 - 4 of 4
Show