Morpholino

MO4-ift88

ID

ZDB-MRPHLNO-050513-2

Name

MO4-ift88

Previous Names

MO4-ttc10 (1)

Target

ift88 (1)

Sequence

5' - CAACTCCACTCACCCCATAAGCTGT - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

splice-blocking morpholino to ift88 / ttc10 gene

Genome Resources

None

Target Location

Genomic Features

No data available

Expression

Gene expression in Wild Types + MO4-ift88

No data available

Phenotype

Phenotype resulting from MO4-ift88

Phenotype	Fish	Figures
gastrulation disrupted, abnormal	WT + MO4-ift88	Fig. 1 from McIntyre et al., 2012
left/right pattern formation disrupted, abnormal	WT + MO4-ift88	Fig. 4 from Schneider et al., 2010
notochord increased width, abnormal	WT + MO4-ift88	Fig. 1 from McIntyre et al., 2012
notochord kinked, abnormal	WT + MO4-ift88	Fig. 1 from McIntyre et al., 2012
phototaxis decreased occurrence, abnormal	AB/EKW + MO4-ift88	Fig. 5 from Tsai et al., 2019
retinal outer nuclear layer cytoplasm ab5-rho labeling mislocalised, abnormal	AB/EKW + MO4-ift88	Fig. 5 from Tsai et al., 2019
somite increased width, abnormal	WT + MO4-ift88	Fig. 1 from McIntyre et al., 2012
whole organism curved, abnormal	TU + MO4-ift88	Figure 5 from Sun et al., 2024
whole organism anterior side disorganized, abnormal	WT + MO4-ift88	Fig. 1 from McIntyre et al., 2012
whole organism anterior-posterior axis shortened, abnormal	WT + MO4-ift88	Fig. 1 from McIntyre et al., 2012

Phenotype of all Fish created by or utilizing MO4-ift88

Phenotype	Fish	Conditions	Figures
phototaxis decreased occurrence, abnormal	AB/EKW + MO4-ift88	standard conditions	Fig. 5 from Tsai et al., 2019
retinal outer nuclear layer cytoplasm ab5-rho labeling mislocalised, abnormal	AB/EKW + MO4-ift88	standard conditions	Fig. 5 from Tsai et al., 2019
whole organism curved, abnormal	TU + MO4-ift88	standard conditions	Figure 5 from Sun et al., 2024
gastrulation disrupted, abnormal	WT + MO4-ift88	standard conditions	Fig. 1 from McIntyre et al., 2012
whole organism anterior side disorganized, abnormal	WT + MO4-ift88	standard conditions	Fig. 1 from McIntyre et al., 2012
notochord increased width, abnormal	WT + MO4-ift88	standard conditions	Fig. 1 from McIntyre et al., 2012
somite increased width, abnormal	WT + MO4-ift88	standard conditions	Fig. 1 from McIntyre et al., 2012
left/right pattern formation disrupted, abnormal	WT + MO4-ift88	standard conditions	Fig. 4 from Schneider et al., 2010
notochord kinked, abnormal	WT + MO4-ift88	standard conditions	Fig. 1 from McIntyre et al., 2012
whole organism anterior-posterior axis shortened, abnormal	WT + MO4-ift88	standard conditions	Fig. 1 from McIntyre et al., 2012
anterior crista intraciliary transport particle GFP expression decreased amount, abnormal	ouc2036Tg/ouc2036Tg + MO4-ift88	standard conditions	Figure 5 from Sun et al., 2024
anterior crista intraciliary transport particle decreased velocity, abnormal	ouc2036Tg/ouc2036Tg + MO4-ift88	standard conditions	Figure 5 from Sun et al., 2024
anterior crista intraciliary transport particle decreased amount, abnormal	ouc2036Tg/ouc2036Tg + MO4-ift88	standard conditions	Figure 5 from Sun et al., 2024
anterior crista intraciliary transport particle GFP expression spatial pattern, abnormal	ouc2036Tg/ouc2036Tg + MO4-ift88	standard conditions	Figure 5 from Sun et al., 2024
anterior crista cilium ab2-tub-glyc labeling spatial pattern, abnormal	ouc2036Tg/ouc2036Tg + MO4-ift88	standard conditions	Figure 5 from Sun et al., 2024
retinal outer nuclear layer ab5-rho labeling position, ameliorated	AB/EKW + MO1-usp38 + MO4-ift88	standard conditions	Fig. 5 from Tsai et al., 2019
phototaxis occurrence, ameliorated	AB/EKW + MO1-usp38 + MO4-ift88	standard conditions	Fig. 5 from Tsai et al., 2019

Citations