Morpholino
MO1-ved
- ID
- ZDB-MRPHLNO-050509-6
- Name
- MO1-ved
- Previous Names
- Target
- Sequence
-
5' - ACTCGATGGAGAACTGACCCTTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ved
No data available
Phenotype
Phenotype resulting from MO1-ved
No data available
Phenotype of all Fish created by or utilizing MO1-ved
1 - 5 of 23 Show all
Citations
- Zhao, J., Lambert, G., Meijer, A.H., and Rosa, F.M. (2013) The transcription factor Vox represses endoderm development by interacting with Casanova and Pou2. Development (Cambridge, England). 140(5):1090-1099
- Seebald, J.L., and Szeto, D.P. (2011) Zebrafish eve1 regulates the lateral and ventral fates of mesodermal progenitor cells at the onset of gastrulation. Developmental Biology. 349(1):78-89
- Ramel, M.C., Buckles, G.R., Baker, K.D., and Lekven, A.C. (2005) WNT8 and BMP2B co-regulate non-axial mesoderm patterning during zebrafish gastrulation. Developmental Biology. 287(2):237-248
- Shimizu, T., Bae, Y.K., Muraoka, O., and Hibi, M. (2005) Interaction of Wnt and caudal-related genes in zebrafish posterior body formation. Developmental Biology. 279(1):125-141
- Shimizu, T., Yamanaka, Y., Nojima, H., Yabe, T., Hibi, M., and Hirano, T. (2002) A novel repressor-type homeobox gene, ved, is involved in dharma/bozozok-mediated dorsal organizer formation in zebrafish. Mechanisms of Development. 118(1-2):125-38
1 - 5 of 5
Show