Morpholino
MO2-lft1
- ID
- ZDB-MRPHLNO-050425-3
- Name
- MO2-lft1
- Previous Names
-
- lft1 MO (1)
- Target
- Sequence
-
5' - GGCGCGGACTGAAGTCATCTTTTCA - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
lefty1 start codon morpholino
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-lft1
No data available
Phenotype
Phenotype resulting from MO2-lft1
Phenotype | Fish | Figures |
---|---|---|
determination of left/right symmetry disrupted, abnormal | WT + MO2-lft1 |
Fig. 3 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-lft1
Phenotype | Fish | Conditions | Figures |
---|---|---|---|
determination of left/right symmetry disrupted, abnormal | WT + MO2-lft1 | standard conditions |
Fig. 3 ![]() |
1 - 1 of 1
Citations
- Wang, X., and Yost, H.J. (2008) Initiation and propagation of posterior to anterior (PA) waves in zebrafish left-right development. Developmental Dynamics : an official publication of the American Association of Anatomists. 237(12):3640-3647
- Essner, J.J., Amack, J.D., Nyholm, M.K., Harris, E.B., and Yost, H.J. (2005) Kupffer's vesicle is a ciliated organ of asymmetry in the zebrafish embryo that initiates left-right development of the brain, heart and gut. Development (Cambridge, England). 132(6):1247-1260
1 - 2 of 2
Show