Morpholino
MO2-igfbp3
- ID
- ZDB-MRPHLNO-050419-1
- Name
- MO2-igfbp3
- Previous Names
-
- MO8A (1)
- Target
- Sequence
-
5' - TCACCTCACCTGGATCTATGATTAC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-igfbp3
No data available
Phenotype
Phenotype resulting from MO2-igfbp3
Phenotype | Fish | Figures |
---|---|---|
pharyngeal arch non-functional, abnormal | WT + MO2-igfbp3 |
Fig. 8
from Zhong et al., 2011 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-igfbp3
1 - 5 of 8 Show all
Citations
- Wan, J., Zhao, X.F., Vojtek, A., Goldman, D. (2014) Retinal Injury, Growth Factors, and Cytokines Converge on β-Catenin and pStat3 Signaling to Stimulate Retina Regeneration. Cell Reports. 9(1):285-97
- Zhong, Y., Lu, L., Zhou, J., Li, Y., Liu, Y., Clemmons, D.R., and Duan, C. (2011) IGF binding protein 3 exerts its ligand-independent action by antagonizing BMP in zebrafish embryos. Journal of Cell Science. 124(11):1925-1935
- Li, Y., Xiang, J., and Duan, C. (2005) Insulin-like Growth Factor-binding Protein-3 Plays an Important Role in Regulating Pharyngeal Skeleton and Inner Ear Formation and Differentiation. The Journal of biological chemistry. 280(5):3613-3620
1 - 3 of 3
Show