Morpholino

MO2-aldh1a2

ID
ZDB-MRPHLNO-050316-3
Name
MO2-aldh1a2
Previous Names
  • MOraldh2 (1)
Target
Sequence
5' - GCAGTTCAACTTCACTGGAGGTCAT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-aldh1a2
No data available
Phenotype
Phenotype resulting from MO2-aldh1a2
Phenotype Fish Figures
inferior olive pou4f1 expression decreased amount, abnormal nkhspGFFDMC28CEt; nkuasgfp1aTg + MO2-aldh1a2 Fig. 9 with image from Itoh et al., 2020
inferior olive neuron decreased amount, abnormal nkhspGFFDMC28CEt; nkuasgfp1aTg + MO2-aldh1a2 Fig. 9 with imageFig. 10 with image from Itoh et al., 2020
motor nucleus of vagal nerve anatomical region decreased size, abnormal rw0Tg + MO2-aldh1a2 Fig. 11 with image from Drummond et al., 2013
neuroectoderm znfl1i expression decreased amount, abnormal WT + MO2-aldh1a2 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1h expression decreased amount, abnormal WT + MO2-aldh1a2 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1j expression decreased amount, abnormal WT + MO2-aldh1a2 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1l expression decreased amount, abnormal WT + MO2-aldh1a2 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1g expression decreased amount, abnormal WT + MO2-aldh1a2 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1c expression decreased amount, abnormal WT + MO2-aldh1a2 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1k expression decreased amount, abnormal WT + MO2-aldh1a2 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1b expression decreased amount, abnormal WT + MO2-aldh1a2 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1 expression decreased amount, abnormal WT + MO2-aldh1a2 Fig. 4 with image from Li et al., 2018
retinoic acid receptor signaling pathway decreased process quality, abnormal sk71Tg + MO2-aldh1a2 Fig. 8 with image from Drummond et al., 2013
Phenotype of all Fish created by or utilizing MO2-aldh1a2
Phenotype Fish Conditions Figures
rhombomere 5 decreased distance somite 1, abnormal WT + MO1-aldh1a2 + MO2-aldh1a2 standard conditions Fig. 3 with image from Begemann et al., 2001
paraxial mesoderm development decreased process quality, abnormal WT + MO1-aldh1a2 + MO2-aldh1a2 standard conditions Fig. 3 with image from Begemann et al., 2001
neuroectoderm znfl1l expression decreased amount, abnormal WT + MO2-aldh1a2 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1i expression decreased amount, abnormal WT + MO2-aldh1a2 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1g expression decreased amount, abnormal WT + MO2-aldh1a2 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1b expression decreased amount, abnormal WT + MO2-aldh1a2 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1h expression decreased amount, abnormal WT + MO2-aldh1a2 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1k expression decreased amount, abnormal WT + MO2-aldh1a2 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1j expression decreased amount, abnormal WT + MO2-aldh1a2 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1 expression decreased amount, abnormal WT + MO2-aldh1a2 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1c expression decreased amount, abnormal WT + MO2-aldh1a2 standard conditions Fig. 4 with image from Li et al., 2018
motor nucleus of vagal nerve anatomical region decreased size, abnormal rw0Tg + MO2-aldh1a2 standard conditions Fig. 11 with image from Drummond et al., 2013
retinoic acid receptor signaling pathway decreased process quality, abnormal sk71Tg + MO2-aldh1a2 standard conditions Fig. 8 with image from Drummond et al., 2013
inferior olive pou4f1 expression decreased amount, abnormal nkhspGFFDMC28CEt; nkuasgfp1aTg + MO2-aldh1a2 standard conditions Fig. 9 with image from Itoh et al., 2020
inferior olive neuron decreased amount, abnormal nkhspGFFDMC28CEt; nkuasgfp1aTg + MO2-aldh1a2 standard conditions Fig. 9 with imageFig. 10 with image from Itoh et al., 2020
inferior olive neuron increased amount, abnormal mafbankgsaizgffm35aGt; nkuasgfp1aTg; nns30Tg + MO2-aldh1a2 standard conditions Fig. 9 with image from Itoh et al., 2020
hindbrain RFP expression decreased amount, abnormal mafbankgsaizgffm35aGt; nkuasgfp1aTg; nns30Tg + MO2-aldh1a2 standard conditions Fig. 9 with image from Itoh et al., 2020
hindbrain EGFP expression increased amount, abnormal mafbankgsaizgffm35aGt; nkuasgfp1aTg; nns30Tg + MO2-aldh1a2 standard conditions Fig. 9 with image from Itoh et al., 2020
Citations