Morpholino

MO1-cyp26a1

ID
ZDB-MRPHLNO-050316-1
Name
MO1-cyp26a1
Previous Names
None
Target
Sequence
5' - CGCGCAACTGATCGCCAAAACGAAA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-cyp26a1
No data available
Phenotype
Phenotype resulting from MO1-cyp26a1
Phenotype Fish Figures
anterior/posterior pattern specification involved in pronephros development disrupted, abnormal TU + MO1-cyp26a1 Fig. 5 with image from Naylor et al., 2016
blood circulation disrupted, abnormal WT + MO1-cyp26a1 Fig. 7 from Echeverri et al., 2007
eye decreased size, abnormal WT + MO1-cyp26a1 Fig. 7 from Echeverri et al., 2007
neuroectoderm znfl1 expression increased amount, abnormal WT + MO1-cyp26a1 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1k expression increased amount, abnormal WT + MO1-cyp26a1 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1j expression increased amount, abnormal WT + MO1-cyp26a1 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1g expression increased amount, abnormal WT + MO1-cyp26a1 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1c expression increased amount, abnormal WT + MO1-cyp26a1 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1h expression increased amount, abnormal WT + MO1-cyp26a1 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1b expression increased amount, abnormal WT + MO1-cyp26a1 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1i expression increased amount, abnormal WT + MO1-cyp26a1 Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1l expression increased amount, abnormal WT + MO1-cyp26a1 Fig. 4 with image from Li et al., 2018
pectoral fin bud decreased size, abnormal WT + MO1-cyp26a1 Fig. 7 from Echeverri et al., 2007
post-vent region structure, abnormal WT + MO1-cyp26a1 Fig. 7 from Echeverri et al., 2007
pronephric distal early tubule slc12a1 expression mislocalised, abnormal TU + MO1-cyp26a1 Fig. 5 with image from Naylor et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-cyp26a1 Fig. 5 with image from Naylor et al., 2016
pronephric proximal convoluted tubule slc4a4a expression increased distribution, abnormal TU + MO1-cyp26a1 Fig. 5 with image from Naylor et al., 2016
pronephric proximal straight tubule slc4a4a expression increased distribution, abnormal TU + MO1-cyp26a1 Fig. 5 with image from Naylor et al., 2016
pronephros wholly anteriorized, abnormal TU + MO1-cyp26a1 Fig. 5 with image from Naylor et al., 2016
rhombomere 6 increased distance somite 1, abnormal WT + MO1-cyp26a1 Fig. 3 with image from Li et al., 2018
somite spatial pattern, abnormal WT + MO1-cyp26a1 Fig. 7 from Echeverri et al., 2007
whole organism increased curvature, abnormal WT + MO1-cyp26a1 Fig. 7 from Echeverri et al., 2007
yolk increased accumulation blood, abnormal WT + MO1-cyp26a1 Fig. 7 from Echeverri et al., 2007
Phenotype of all Fish created by or utilizing MO1-cyp26a1
Phenotype Fish Conditions Figures
pronephric proximal convoluted tubule slc4a4a expression increased distribution, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
pronephros wholly anteriorized, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
pronephric distal late tubule slc12a3 expression decreased distribution, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
pronephric proximal straight tubule slc4a4a expression increased distribution, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
pronephric distal early tubule slc12a1 expression mislocalised, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
anterior/posterior pattern specification involved in pronephros development disrupted, abnormal TU + MO1-cyp26a1 standard conditions Fig. 5 with image from Naylor et al., 2016
post-vent region structure, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
neuroectoderm znfl1 expression increased amount, abnormal WT + MO1-cyp26a1 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1b expression increased amount, abnormal WT + MO1-cyp26a1 standard conditions Fig. 4 with image from Li et al., 2018
blood circulation disrupted, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
neuroectoderm znfl1k expression increased amount, abnormal WT + MO1-cyp26a1 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1h expression increased amount, abnormal WT + MO1-cyp26a1 standard conditions Fig. 4 with image from Li et al., 2018
yolk increased accumulation blood, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
pectoral fin bud decreased size, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
somite spatial pattern, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
whole organism increased curvature, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
neuroectoderm znfl1i expression increased amount, abnormal WT + MO1-cyp26a1 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1g expression increased amount, abnormal WT + MO1-cyp26a1 standard conditions Fig. 4 with image from Li et al., 2018
neuroectoderm znfl1l expression increased amount, abnormal WT + MO1-cyp26a1 standard conditions Fig. 4 with image from Li et al., 2018
eye decreased size, abnormal WT + MO1-cyp26a1 standard conditions Fig. 7 from Echeverri et al., 2007
neuroectoderm znfl1j expression increased amount, abnormal WT + MO1-cyp26a1 standard conditions Fig. 4 with image from Li et al., 2018
rhombomere 6 increased distance somite 1, abnormal WT + MO1-cyp26a1 standard conditions Fig. 3 with image from Li et al., 2018
neuroectoderm znfl1c expression increased amount, abnormal WT + MO1-cyp26a1 standard conditions Fig. 4 with image from Li et al., 2018
rhombomere 6 distance somite 1, ameliorated WT + MO1-cyp26a1 + MO1-znfl1 standard conditions Fig. 3 with image from Li et al., 2018
Citations