Morpholino
MO1-kif7
- ID
- ZDB-MRPHLNO-050307-1
- Name
- MO1-kif7
- Previous Names
-
- Cos2START (1)
- Target
- Sequence
-
5' - GCCGACTCCTTTTGGAGACATAGCT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
This is a translation blocking morpholino that targets kif7.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kif7
No data available
Phenotype
Phenotype resulting from MO1-kif7
1 - 5 of 11 Show all
Phenotype of all Fish created by or utilizing MO1-kif7
1 - 5 of 33 Show all
Citations
- Liu, Y.C., Couzens, A.L., Deshwar, A.R., B McBroom-Cerajewski, L.D., Zhang, X., Puviindran, V., Scott, I.C., Gingras, A.C., Hui, C.C., Angers, S. (2014) The PPFIA1-PP2A protein complex promotes trafficking of Kif7 to the ciliary tip and Hedgehog signaling. Science signaling. 7:ra117
- Putoux, A., Thomas, S., Coene, K.L.M., Davis, E.E., Alanay, Y., Ogur, G., Uz, E., Buzas, D., Gomes, C., Patrier, S., Bennett, C.L., Elkhartoufi, N., Saint Frison, M.H., Rigonnot, L., Joye, N., Pruvost, S., Utine, G.E., Boduroglu, K., Nitschke, P., Fertitta, L., Thauvin-Robinet, C., Munnich, A., Cormier-Daire, V., Hennekam, R., Colin, E., Akarsu, N.A., Bole-Feysot, C., Cagnard, N., Schmitt, A., Goudin, N., Lyonnet, S., Encha-Razavi, F., Siffroi, J.P., Winey, M., Katsanis, N., Gonzales, M., Vekemans, M., Beales, P.L., and Attie-Bitach, T. (2011) KIF7 mutations cause fetal hydrolethalus and acrocallosal syndromes. Nature Genetics. 43:601-606
- Wilson, C.W., Nguyen, C.T., Chen, M.H., Yang, J.H., Gacayan, R., Huang, J., Chen, J.N., and Chuang, P.T. (2009) Fused has evolved divergent roles in vertebrate Hedgehog signalling and motile ciliogenesis. Nature. 459(7243):98-102
- Tay, S.Y., Ingham, P.W., and Roy, S. (2005) A homologue of the Drosophila kinesin-like protein Costal2 regulates Hedgehog signal transduction in the vertebrate embryo. Development (Cambridge, England). 132(4):625-634
1 - 4 of 4
Show