Morpholino

MO1-kif7

ID
ZDB-MRPHLNO-050307-1
Name
MO1-kif7
Previous Names
  • Cos2START (1)
Target
Sequence
5' - GCCGACTCCTTTTGGAGACATAGCT - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This is a translation blocking morpholino that targets kif7.
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-kif7
No data available
Phenotype
Phenotype resulting from MO1-kif7
Phenotype Fish Figures
determination of left/right symmetry disrupted, abnormal AB + MO1-kif7 + MO4-tp53 Fig. 3 from Wilson et al., 2009
eye decreased size, abnormal WT + MO1-kif7 Fig. 2 from Putoux et al., 2011
head decreased size, abnormal WT + MO1-kif7 Fig. 2 from Putoux et al., 2011
heart looping disrupted, abnormal AB + MO1-kif7 + MO4-tp53 Fig. 3 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-kif7 + MO4-tp53 Fig. 3 from Wilson et al., 2009
heart tube symmetry, abnormal AB + MO1-kif7 + MO4-tp53 Fig. 3 from Wilson et al., 2009
notochord kinked, abnormal WT + MO1-kif7 Fig. 2 from Putoux et al., 2011
somite increased width, abnormal WT + MO1-kif7 Fig. 2 from Putoux et al., 2011
somite obtuse angle to somite, abnormal WT + MO1-kif7 Fig. 3 from Liu et al., 2014
somite shape, abnormal WT + MO1-kif7 Fig. 3 from Liu et al., 2014
Fig. 2 from Putoux et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-kif7 Fig. 2 from Putoux et al., 2011
Phenotype of all Fish created by or utilizing MO1-kif7
Phenotype Fish Conditions Figures
heart looping disrupted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube symmetry, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
determination of left/right symmetry disrupted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
heart tube inverted, abnormal AB + MO1-kif7 + MO4-tp53 standard conditions Fig. 3 from Wilson et al., 2009
somite increased width, abnormal WT + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
somite obtuse angle to somite, abnormal WT + MO1-kif7 standard conditions Fig. 3 from Liu et al., 2014
notochord kinked, abnormal WT + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
head decreased size, abnormal WT + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
somite shape, abnormal WT + MO1-kif7 standard conditions Fig. 3 from Liu et al., 2014
Fig. 2 from Putoux et al., 2011
eye decreased size, abnormal WT + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
myotome muscle pioneer increased amount, abnormal WT + MO1-kif7 + MO2-kif7 standard conditions Fig. 4 with image from Tay et al., 2005
myotome fast muscle cell increased amount, abnormal WT + MO1-kif7 + MO2-kif7 standard conditions Fig. 4 with image from Tay et al., 2005
somite shape, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
eye decreased size, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
head decreased size, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
notochord kinked, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
somite increased width, abnormal WT + MO1-bbs1 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
head decreased size, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
somite increased width, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
eye decreased size, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
somite shape, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
notochord kinked, abnormal WT + MO1-bbs7 + MO1-kif7 standard conditions Fig. 2 from Putoux et al., 2011
myotome fast muscle cell increased amount, abnormal WT + MO1-kif7 + MO1-sufu + MO2-kif7 + MO2-sufu standard conditions Fig. 7 with image from Tay et al., 2005
myotome muscle pioneer increased amount, abnormal WT + MO1-kif7 + MO1-sufu + MO2-kif7 + MO2-sufu standard conditions Fig. 7 with image from Tay et al., 2005
eye decreased size, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
somite shape, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
notochord kinked, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
head decreased size, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
whole organism anterior-posterior axis decreased length, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
somite increased width, abnormal WT + MO1-kif7 + MO3-bbs9 standard conditions Fig. 2 from Putoux et al., 2011
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.