Morpholino
MO2-tp63
- ID
- ZDB-MRPHLNO-050204-5
- Name
- MO2-tp63
- Previous Names
- Target
- Sequence
-
5' - CCCTAGTTTTCTTCCTTTTATCCCC - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-tp63
No data available
Phenotype
Phenotype resulting from MO2-tp63
| Phenotype | Fish | Figures |
|---|---|---|
| periderm cell decreased amount, abnormal | WT + MO2-tp63 |
Fig. 5 |
| peridermal cell increased size, abnormal | zf106Tg + MO2-tp63 |
Fig. 5 |
Phenotype of all Fish created by or utilizing MO2-tp63
Citations