Morpholino
MO1-irx3a
- ID
- ZDB-MRPHLNO-050204-1
- Name
- MO1-irx3a
- Previous Names
- Target
- Sequence
-
5' - AGCTGTGGGAAAGACATTGTTGTGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
A translation blocking morpholino against irx3a
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-irx3a
No data available
Phenotype
Phenotype resulting from MO1-irx3a
No data available
Phenotype of all Fish created by or utilizing MO1-irx3a
1 - 3 of 3
Citations
- Ragvin, A., Moro, E., Fredman, D., Navratilova, P., Drivenes, O., Engström, P.G., Alonso, M.E., Mustienes, E.D., Gomez Skarmeta, J.L., Tavares, M.J., Casares, F., Manzanares, M., van Heyningen, V., Molven, A., Njølstad, P.R., Argenton, F., Lenhard, B., and Becker, T.S. (2010) Long-range gene regulation links genomic type 2 diabetes and obesity risk regions to HHEX, SOX4, and IRX3. Proceedings of the National Academy of Sciences of the United States of America. 107(2):775-780
- Lewis, K.E., Bates, J., and Eisen, J.S. (2005) Regulation of iro3 expression in the zebrafish spinal cord. Developmental Dynamics : an official publication of the American Association of Anatomists. 232(1):140-148
1 - 2 of 2
Show