Morpholino
MO1-bmal1a
- ID
- ZDB-MRPHLNO-050119-3
- Name
- MO1-bmal1a
- Previous Names
-
- arntl1a MO
- MO1-arntl1a
- Target
- Sequence
-
5' - TATCCATTCTTTGGTCTGCCATTAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
- None
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-bmal1a
No data available
Phenotype
Phenotype resulting from MO1-bmal1a
| Phenotype | Fish | Figures |
|---|---|---|
| intersegmental vessel shortened, abnormal | y1Tg + MO1-bmal1a |
Fig. 2  ,
Fig. 3
from Jensen et al., 2012 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-bmal1a
1 - 3 of 3
Citations
- Jensen, L.D., Cao, Z., Nakamura, M., Yang, Y., Bräutigam, L., Andersson, P., Zhang, Y., Wahlberg, E., Länne, T., Hosaka, K., and Cao, Y. (2012) Opposing Effects of Circadian Clock Genes Bmal1 and Period2 in Regulation of VEGF-Dependent Angiogenesis in Developing Zebrafish. Cell Reports. 2(2):231-241
- Triqueneaux, G., Thenot, S., Kakizawa, T., Antoch, M.P., Safi, R., Takahashi, J.S., Delaunay, F., and Laudet, V. (2004) The orphan receptor Rev-erb{alpha} gene is a target of the circadian clock pacemaker. Journal of molecular endocrinology. 33(3):585-608
1 - 2 of 2
Show