Morpholino
MO1-notch1a
- ID
- ZDB-MRPHLNO-041207-4
- Name
- MO1-notch1a
- Previous Names
-
- MO-notch1a-1 (1)
- Target
- Sequence
-
5' - GAAACGGTTCATAACTCCGCCTCGG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
designed to bind to 5'-end of gene
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-notch1a
No data available
Phenotype
Phenotype resulting from MO1-notch1a
Phenotype | Fish | Figures |
---|---|---|
choroid plexus fourth ventricle shape, abnormal | mn16Et + MO1-notch1a |
Fig. 5 ![]() |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO1-notch1a
1 - 5 of 17 Show all
Citations
- Campbell, L.J., Hobgood, J.S., Jia, M., Boyd, P., Hipp, R.I., Hyde, D.R. (2020) Notch3 and DeltaB maintain Müller glia quiescence and act as negative regulators of regeneration in the light-damaged zebrafish retina. Glia. 69(3):546-566
- Zhang, C., Chen, Y., Sun, B., Wang, L., Yang, Y., Ma, D., Lv, J., Heng, J., Ding, Y., Xue, Y., Lu, X., Xiao, W., Yang, Y.G., Liu, F. (2017) m6A modulates haematopoietic stem and progenitor cell specification.. Nature. 549(7671):273-276
- Bainbridge, M.N., Davis, E.E., Choi, W.Y., Dickson, A., Martinez, H.R., Wang, M., Dinh, H., Muzny, D., Pignatelli, R., Katsanis, N., Boerwinkle, E., Gibbs, R., Jefferies, J.L. (2015) Loss of Function Mutations in NNT Are Associated with Left Ventricular Noncompaction. Circulation. Cardiovascular genetics. 8(4):544-52
- Kressmann, S., Campos, C., Castanon, I., Fürthauer, M., González-Gaitán, M. (2015) Directional Notch trafficking in Sara endosomes during asymmetric cell division in the spinal cord. Nature cell biology. 17(3):333-9
- Da'as, S.I., Coombs, A.J., Balci, T.B., Grondin, C.A., Ferrando, A.A., and Berman, J.N. (2012) The zebrafish reveals dependence of the mast cell lineage on Notch signaling in vivo. Blood. 119(15):3585-3594
- Uribe, R.A., Kwon, T., Marcotte, E.M., and Gross, J.M. (2012) Id2a functions to limit Notch pathway activity and thereby influence the transition from proliferation to differentiation of retinoblasts during zebrafish retinogenesis. Developmental Biology. 371(2):280-292
- Ishitani, T., Hirao, T., Suzuki, M., Isoda, M., Ishitani, S., Harigaya, K., Kitagawa, M., Matsumoto, K., and Itoh, M. (2010) Nemo-like kinase suppresses Notch signalling by interfering with formation of the Notch active transcriptional complex. Nature cell biology. 12(3):278-285
- Matsuda, M., and Chitnis, A.B. (2010) Atoh1a expression must be restricted by Notch signaling for effective morphogenesis of the posterior lateral line primordium in zebrafish. Development (Cambridge, England). 137(20):3477-3487
- Matsuda, M., and Chitnis, A.B. (2009) Interaction with Notch determines endocytosis of specific Delta ligands in zebrafish neural tissue. Development (Cambridge, England). 136(2):197-206
- So, J.H., Chun, H.S., Bae, Y.K., Kim, H.S., Park, Y.M., Huh, T.L., Chitnis, A.B., Kim, C.H., and Yeo, S.Y. (2009) Her4 is necessary for establishing peripheral projections of the trigeminal ganglia in zebrafish. Biochemical and Biophysical Research Communications. 379(1):22-26
1 - 10 of 14
Show