Morpholino
MO1-ihhb
- ID
- ZDB-MRPHLNO-041129-3
- Name
- MO1-ihhb
- Previous Names
- Target
- Sequence
-
5' - GAGGAGCGCCGCCGCCGTGGAGAGTCTCAT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
A translation blocking morpholino targeting ehh.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-ihhb
No data available
Phenotype
Phenotype resulting from MO1-ihhb
1 - 5 of 6 Show all
Phenotype of all Fish created by or utilizing MO1-ihhb
1 - 5 of 11 Show all
Citations
- Chung, A.Y., Kim, S., Kim, E., Kim, D., Jeong, I., Cha, Y.R., Bae, Y.K., Park, S.W., Lee, J., and Park, H.C. (2013) Indian hedgehog B function is required for the specification of oligodendrocyte progenitor cells in the zebrafish CNS. The Journal of neuroscience : the official journal of the Society for Neuroscience. 33(4):1728-1733
- Cheesman, S.E., Layden, M.J., Von Ohlen, T., Doe, C.Q., and Eisen, J.S. (2004) Zebrafish and fly Nkx6 proteins have similar CNS expression patterns and regulate motoneuron formation. Development (Cambridge, England). 131(21):5221-5232
- Lewis, K.E. and Eisen, J.S. (2001) Hedgehog signaling is required for primary motoneuron induction in zebrafish. Development (Cambridge, England). 128(18):3485-3495
1 - 3 of 3
Show