Morpholino
MO2-shhb
- ID
- ZDB-MRPHLNO-041129-2
- Name
- MO2-shhb
- Previous Names
- Target
- Sequence
-
5' - TCCATGACGTTTGAATTATCTCTT - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
A translation blocking morpholino targeting twhh. These embryos have a normal head, v-shaped somites, and a normal myoseptum.
- Genome Resources
- None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO2-shhb
No data available
Phenotype
Phenotype resulting from MO2-shhb
| Phenotype | Fish | Figures |
|---|---|---|
| odontogenesis arrested, abnormal | WT + MO2-shhb |
Fig. 3 
from Jackman et al., 2010 |
1 - 1 of 1
Phenotype of all Fish created by or utilizing MO2-shhb
1 - 5 of 6 Show all
Citations
- Chalasani, K., and Brewster, R.M. (2011) N-cadherin-mediated cell adhesion restricts cell proliferation in the dorsal neural tube. Molecular biology of the cell. 22(9):1505-1515
- Jackman, W.R., Yoo, J.J., and Stock, D.W. (2010) Hedgehog signaling is required at multiple stages of zebrafish tooth development. BMC Developmental Biology. 10:119
- Eberhart, J.K., Swartz, M.E., Crump, J.G., and Kimmel, C.B. (2006) Early Hedgehog signaling from neural to oral epithelium organizes anterior craniofacial development. Development (Cambridge, England). 133(6):1069-1077
- Lewis, K.E., Bates, J., and Eisen, J.S. (2005) Regulation of iro3 expression in the zebrafish spinal cord. Developmental Dynamics : an official publication of the American Association of Anatomists. 232(1):140-148
- Masai, I., Yamaguchi, M., Tonou-Fujimori, N., Komori, A., and Okamoto, H. (2005) The hedgehog-PKA pathway regulates two distinct steps of the differentiation of retinal ganglion cells: the cell-cycle exit of retinoblasts and their neuronal maturation. Development (Cambridge, England). 132(7):1539-1553
- Wada, N., Javidan, Y., Nelson, S., Carney, T.J., Kelsh, R.N., Schilling, T.F. (2005) Hedgehog signaling is required for cranial neural crest morphogenesis and chondrogenesis at the midline in the zebrafish skull. Development (Cambridge, England). 132(17):3977-3988
- Cheesman, S.E., Layden, M.J., Von Ohlen, T., Doe, C.Q., and Eisen, J.S. (2004) Zebrafish and fly Nkx6 proteins have similar CNS expression patterns and regulate motoneuron formation. Development (Cambridge, England). 131(21):5221-5232
- Park, H.C., Shin, J., and Appel, B. (2004) Spatial and temporal regulation of ventral spinal cord precursor specification by Hedgehog signaling. Development (Cambridge, England). 131(23):5959-5969
- Etheridge, L.A., Wu, T., Liang, J.O., Ekker, S.C., and Halpern, M.E. (2001) Floor plate develops upon depletion of tiggy-winkle and sonic hedgehog. Genesis (New York, N.Y. : 2000). 30(3):164-169
- Lewis, K.E. and Eisen, J.S. (2001) Hedgehog signaling is required for primary motoneuron induction in zebrafish. Development (Cambridge, England). 128(18):3485-3495
1 - 10 of 11
Show