Morpholino

MO1-hdac1

ID
ZDB-MRPHLNO-041116-3
Name
MO1-hdac1
Previous Names
  • hdac-1 MO (1)
  • hdac1-MO (1)
Target
Sequence
5' - TGTTCCTTGAGAACTCAGCGCCATT - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Genomic Features
No data available
Expression
Gene expression in Wild Types + MO1-hdac1
No data available
Phenotype
Phenotype resulting from MO1-hdac1
Phenotype Fish Figures
blood circulation disrupted, abnormal y1Tg + MO1-hdac1 Fig. 3 from Pillai et al., 2004
brain morphology, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
caudal fin curved ventral, abnormal AB + MO1-hdac1 Fig. 2 with image from Loponte et al., 2016
ceratohyal cartilage absent, abnormal y1Tg + MO1-hdac1 Fig. 4 from Pillai et al., 2004
cranial cartilage aplastic, abnormal gz15Tg + MO1-hdac1 Fig. 6 with image from Farooq et al., 2008
exocrine pancreas prss1 expression decreased distribution, abnormal AB + MO1-hdac1 Fig. 2 from Zhou et al., 2011
exocrine pancreas morphology, abnormal AB + MO1-hdac1 Fig. 2 from Zhou et al., 2011
exocrine pancreas growth decreased occurrence, abnormal AB + MO1-hdac1 Fig. 2 from Zhou et al., 2011
exocrine pancreas development paedomorphic growth, abnormal WT + MO1-hdac1 Fig. 6 with image from Farooq et al., 2008
exocrine pancreas development process quality, abnormal AB + MO1-hdac1 Fig. 2 from Zhou et al., 2011
eye decreased size, abnormal gz15Tg + MO1-hdac1 Fig. 6 with image from Farooq et al., 2008
facial nerve motor nucleus morphology, abnormal WT + MO1-hdac1 Fig. 7 with image from Nambiar et al., 2007
forebrain ventricle increased size, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
forebrain ventricle morphology, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
head neurod4 expression decreased amount, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
head trim9 expression decreased amount, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
head lhx9 expression decreased amount, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
head inpp5ka expression decreased amount, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
head gsx1 expression decreased amount, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
head decreased size, abnormal AB + MO1-hdac1 Fig. 2 with image from Loponte et al., 2016
Fig. 6 with image from Farooq et al., 2008
head tlr3 expression increased amount, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
head phlda3 expression increased amount, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
head gadd45aa expression increased amount, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
head dlb expression increased amount, abnormal AB + MO1-hdac1 Fig. 3 with image from Loponte et al., 2016
heart decreased functionality, abnormal y1Tg + MO1-hdac1 Fig. 3 from Pillai et al., 2004
heart edematous, abnormal gz15Tg + MO1-hdac1 Fig. 6 with image from Farooq et al., 2008
hyosymplectic cartilage absent, abnormal y1Tg + MO1-hdac1 Fig. 4 from Pillai et al., 2004
liver decreased size, abnormal gz15Tg + MO1-hdac1 Fig. 9 with image from Farooq et al., 2008
liver development paedomorphic growth, abnormal gz15Tg + MO1-hdac1 Fig. 6 with imageFig. 9 with image from Farooq et al., 2008
mandibular arch skeleton decreased size, abnormal AB + MO1-hdac1 Fig. 2 with image from Loponte et al., 2016
Meckel's cartilage absent, abnormal y1Tg + MO1-hdac1 Fig. 4 from Pillai et al., 2004
melanocyte mislocalised, abnormal WT + MO1-hdac1 Fig. 7 with image from Nambiar et al., 2007
melanocyte migration disrupted, abnormal AB + MO1-hdac1 Fig. 2 with image from Loponte et al., 2016
motor neuron mislocalised, abnormal WT + MO1-hdac1 Fig. 7 with image from Nambiar et al., 2007
neuron migration disrupted, abnormal WT + MO1-hdac1 Fig. 7 with image from Nambiar et al., 2007
otolith decreased distance otolith, abnormal AB + MO1-hdac1 Fig. 2 with image from Loponte et al., 2016
otolith decreased size, abnormal AB + MO1-hdac1 Fig. 2 with image from Loponte et al., 2016
palatoquadrate cartilage absent, abnormal y1Tg + MO1-hdac1 Fig. 4 from Pillai et al., 2004
pancreatic acinar gland absent, abnormal AB + MO1-hdac1 Fig. 2 from Zhou et al., 2011
pectoral fin aplastic, abnormal AB + MO1-hdac1 Fig. 2 with image from Loponte et al., 2016
Fig. 7 with image from Nambiar et al., 2007
pectoral fin cartilage absent, abnormal y1Tg + MO1-hdac1 Fig. 4 from Pillai et al., 2004
pericardium edematous, abnormal AB + MO1-hdac1 Fig. 2 with image from Loponte et al., 2016
pharyngeal arch 3-7 absent, abnormal y1Tg + MO1-hdac1 Fig. 4 from Pillai et al., 2004
presumptive bulbus arteriosus ripply3 expression increased amount, abnormal fb7Tg + MO1-hdac1 + MO4-tp53 Fig 7 with image from Song et al., 2019
presumptive bulbus arteriosus cdkn1a expression increased amount, abnormal fb7Tg + MO1-hdac1 + MO4-tp53 Fig 5 with image from Song et al., 2019
retina disorganized, abnormal y1Tg + MO1-hdac1 Fig. 6 from Pillai et al., 2004
retina layer formation disrupted, abnormal y1Tg + MO1-hdac1 Fig. 6 from Pillai et al., 2004
retinal neural layer disorganized, abnormal y1Tg + MO1-hdac1 Fig. 6 from Pillai et al., 2004
retinal pigmented epithelium broken, abnormal y1Tg + MO1-hdac1 Fig. 6 from Pillai et al., 2004
retinal pigmented epithelium patchy, abnormal y1Tg + MO1-hdac1 Fig. 6 from Pillai et al., 2004
trunk curved, abnormal WT + MO1-hdac1 Fig. 7 with image from Nambiar et al., 2007
Phenotype of all Fish created by or utilizing MO1-hdac1
Phenotype Fish Conditions Figures
head trim9 expression decreased amount, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
head neurod4 expression decreased amount, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
exocrine pancreas growth decreased occurrence, abnormal AB + MO1-hdac1 control Fig. 2 from Zhou et al., 2011
head decreased size, abnormal AB + MO1-hdac1 standard conditions Fig. 2 with image from Loponte et al., 2016
head tlr3 expression increased amount, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
melanocyte migration disrupted, abnormal AB + MO1-hdac1 standard conditions Fig. 2 with image from Loponte et al., 2016
forebrain ventricle morphology, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
brain morphology, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
head gsx1 expression decreased amount, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
exocrine pancreas prss1 expression decreased distribution, abnormal AB + MO1-hdac1 control Fig. 2 from Zhou et al., 2011
otolith decreased distance otolith, abnormal AB + MO1-hdac1 standard conditions Fig. 2 with image from Loponte et al., 2016
head dlb expression increased amount, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
pancreatic acinar gland absent, abnormal AB + MO1-hdac1 control Fig. 2 from Zhou et al., 2011
caudal fin curved ventral, abnormal AB + MO1-hdac1 standard conditions Fig. 2 with image from Loponte et al., 2016
mandibular arch skeleton decreased size, abnormal AB + MO1-hdac1 standard conditions Fig. 2 with image from Loponte et al., 2016
head gadd45aa expression increased amount, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
otolith decreased size, abnormal AB + MO1-hdac1 standard conditions Fig. 2 with image from Loponte et al., 2016
exocrine pancreas development process quality, abnormal AB + MO1-hdac1 control Fig. 2 from Zhou et al., 2011
pericardium edematous, abnormal AB + MO1-hdac1 standard conditions Fig. 2 with image from Loponte et al., 2016
head inpp5ka expression decreased amount, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
exocrine pancreas morphology, abnormal AB + MO1-hdac1 control Fig. 2 from Zhou et al., 2011
forebrain ventricle increased size, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
pectoral fin aplastic, abnormal AB + MO1-hdac1 standard conditions Fig. 2 with image from Loponte et al., 2016
head phlda3 expression increased amount, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
head lhx9 expression decreased amount, abnormal AB + MO1-hdac1 standard conditions Fig. 3 with image from Loponte et al., 2016
neuron migration disrupted, abnormal WT + MO1-hdac1 standard conditions Fig. 7 with image from Nambiar et al., 2007
facial nerve motor nucleus morphology, abnormal WT + MO1-hdac1 standard conditions Fig. 7 with image from Nambiar et al., 2007
pectoral fin aplastic, abnormal WT + MO1-hdac1 standard conditions Fig. 7 with image from Nambiar et al., 2007
trunk curved, abnormal WT + MO1-hdac1 standard conditions Fig. 7 with image from Nambiar et al., 2007
melanocyte mislocalised, abnormal WT + MO1-hdac1 standard conditions Fig. 7 with image from Nambiar et al., 2007
motor neuron mislocalised, abnormal WT + MO1-hdac1 standard conditions Fig. 7 with image from Nambiar et al., 2007
exocrine pancreas development paedomorphic growth, abnormal WT + MO1-hdac1 standard conditions Fig. 6 with image from Farooq et al., 2008
presumptive bulbus arteriosus cdkn1a expression increased amount, abnormal fb7Tg + MO1-hdac1 + MO4-tp53 standard conditions Fig 5 with image from Song et al., 2019
presumptive bulbus arteriosus ripply3 expression increased amount, abnormal fb7Tg + MO1-hdac1 + MO4-tp53 standard conditions Fig 7 with image from Song et al., 2019
head decreased size, abnormal gz15Tg + MO1-hdac1 standard conditions Fig. 6 with image from Farooq et al., 2008
liver development paedomorphic growth, abnormal gz15Tg + MO1-hdac1 standard conditions Fig. 6 with imageFig. 9 with image from Farooq et al., 2008
cranial cartilage aplastic, abnormal gz15Tg + MO1-hdac1 standard conditions Fig. 6 with image from Farooq et al., 2008
liver decreased size, abnormal gz15Tg + MO1-hdac1 standard conditions Fig. 9 with image from Farooq et al., 2008
heart edematous, abnormal gz15Tg + MO1-hdac1 standard conditions Fig. 6 with image from Farooq et al., 2008
eye decreased size, abnormal gz15Tg + MO1-hdac1 standard conditions Fig. 6 with image from Farooq et al., 2008
retina disorganized, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 6 from Pillai et al., 2004
retinal pigmented epithelium broken, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 6 from Pillai et al., 2004
retina layer formation disrupted, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 6 from Pillai et al., 2004
hyosymplectic cartilage absent, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 4 from Pillai et al., 2004
Meckel's cartilage absent, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 4 from Pillai et al., 2004
blood circulation disrupted, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 3 from Pillai et al., 2004
pharyngeal arch 3-7 absent, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 4 from Pillai et al., 2004
retinal neural layer disorganized, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 6 from Pillai et al., 2004
retinal pigmented epithelium patchy, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 6 from Pillai et al., 2004
palatoquadrate cartilage absent, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 4 from Pillai et al., 2004
ceratohyal cartilage absent, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 4 from Pillai et al., 2004
pectoral fin cartilage absent, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 4 from Pillai et al., 2004
heart decreased functionality, abnormal y1Tg + MO1-hdac1 standard conditions Fig. 3 from Pillai et al., 2004
median fin fold degeneration, ameliorated mtm1zf711/zf711 + MO1-hdac1 + MO1-tp53 standard conditions Fig. 1 with image from Volpatti et al., 2022
whole organism curvature, ameliorated pkd2hi4166Tg/hi4166Tg + MO1-hdac1 (AB/TU) standard conditions Fig. 4 with image from Cao et al., 2009
whole organism wholly dorsalized, abnormal WT + MO1-hdac1 + MO1-ppp4cb standard conditions Fig. 7 with image from Jia et al., 2012
liver aplastic, abnormal gz15Tg + MO1-hdac1 + MO1-hdac3 standard conditions Fig. 9 with image from Farooq et al., 2008
intersegmental vessel decreased size, abnormal y1Tg + MO1-hdac1 + MO1-hdac3 standard conditions Fig. 9 with image from Farooq et al., 2008
Citations