Fig. S2
|
Morpholinos (MOs) targeting gnb1 or gnb4 efficiently block translation of the corresponding ectopically expressed (GFP-tagged) proteins. (A-D) Epifluorescence images of groups of embryos injected with 100 pg gnb1a-gfp, gnb1b-gfp, gnb4a-gfp or gnb4b-gfp plasmid DNAs at the one-cell stage; GFP expression is strong at 60%-80% epiboly. (A′-D′) Co-injection of MO (4 ng) significantly suppressed the corresponding GFP expression. The following MOs (Gene-Tools) were used: gnb1a (GAGTTCGCTCATTTTCTTCTGCTTC), gnb1b (CTGGTCCAGTT CACTCATTTT CCTC), gnb4a (CCGCAACTGCTCCAGCTCACT CATG) and gnb4b (GACGCAACTGC TCCAACTCACTCAT). Scale bar: 1 mm. |