CRISPR

CRISPR10-gas5

ID
ZDB-CRISPR-260319-10
Name
CRISPR10-gas5
Previous Names
None
Target
Sequence
5' - GGGATCAAGCTGTATGGAGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first "G" was added.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
No data available
Expression
Gene expression in Wild Types + CRISPR10-gas5
No data available
Phenotype
Phenotype resulting from CRISPR10-gas5
Phenotype Fish Figures
brain gas5 expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 4 with image from Zhou et al., 2024
embryo development disrupted, abnormal AB + CRISPR10-gas5 Figure 4 with image from Zhou et al., 2024
eye gas5 expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 4 with image from Zhou et al., 2024
myotome myod1 expression spatial pattern, abnormal AB + CRISPR10-gas5 Figure 6 with image from Zhou et al., 2024
segmental plate myod1 expression spatial pattern, abnormal AB + CRISPR10-gas5 Figure 6 with image from Zhou et al., 2024
spinal cord gas5 expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 4 with image from Zhou et al., 2024
whole organism mef2ca expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism pax7a expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism si:ch211-198n5.11 expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism myod1 expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism pax3a expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism nkx2-5 expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism calr expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism tor3a expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism rpe65b expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism myhc4 expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism myf6 expression decreased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism decreased life span, abnormal AB + CRISPR10-gas5 Figure 4 with image from Zhou et al., 2024
whole organism myf5 expression increased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism myog expression increased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism srfa expression increased amount, abnormal AB + CRISPR10-gas5 Figure 5 with image from Zhou et al., 2024
whole organism viability, abnormal AB + CRISPR10-gas5 Figure 4 with image from Zhou et al., 2024
Phenotype of all Fish created by or utilizing CRISPR10-gas5
Phenotype Fish Conditions Figures
whole organism viability, abnormal AB + CRISPR10-gas5 standard conditions Figure 4 with image from Zhou et al., 2024
whole organism myf5 expression increased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
whole organism pax3a expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
eye gas5 expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 4 with image from Zhou et al., 2024
whole organism si:ch211-198n5.11 expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
whole organism myf6 expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
whole organism rpe65b expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
myotome myod1 expression spatial pattern, abnormal AB + CRISPR10-gas5 standard conditions Figure 6 with image from Zhou et al., 2024
brain gas5 expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 4 with image from Zhou et al., 2024
segmental plate myod1 expression spatial pattern, abnormal AB + CRISPR10-gas5 standard conditions Figure 6 with image from Zhou et al., 2024
whole organism mef2ca expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
whole organism tor3a expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
whole organism nkx2-5 expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
whole organism calr expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
whole organism srfa expression increased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
whole organism decreased life span, abnormal AB + CRISPR10-gas5 standard conditions Figure 4 with image from Zhou et al., 2024
whole organism pax7a expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
whole organism myod1 expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
whole organism myhc4 expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
embryo development disrupted, abnormal AB + CRISPR10-gas5 standard conditions Figure 4 with image from Zhou et al., 2024
spinal cord gas5 expression decreased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 4 with image from Zhou et al., 2024
whole organism myog expression increased amount, abnormal AB + CRISPR10-gas5 standard conditions Figure 5 with image from Zhou et al., 2024
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to report issues or recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.