CRISPR

CRISPR2-ddx3xa

ID

ZDB-CRISPR-260120-3

Name

CRISPR2-ddx3xa

Previous Names

None

Target

ddx3xa (1)

Sequence

5' - TGGGATGGTAGTCGTACCAA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hn101	ddx3xa
hn102	ddx3xa
hn103	ddx3xa

Expression

Gene expression in Wild Types + CRISPR2-ddx3xa

No data available

Phenotype

Phenotype resulting from CRISPR2-ddx3xa

No data available

Phenotype of all Fish created by or utilizing CRISPR2-ddx3xa

Phenotype	Fish	Conditions	Figures
whole organism ctnnb1 expression increased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 8 from Chen et al., 2025
pericardium edematous, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 5 from Chen et al., 2025
whole organism ptger1b expression increased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
whole organism adcy7 expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
atrium bmp4 expression increased distribution, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 8 from Chen et al., 2025
heart dorsal side tbx5a expression spatial pattern, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 8 from Chen et al., 2025
heart looping decreased process quality, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 5 from Chen et al., 2025
whole organism cxcl12b expression increased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
whole organism regulation of Wnt signaling pathway process quality, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 8 from Chen et al., 2025
whole organism nkx2.5 expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 5 from Chen et al., 2025
whole organism lef1 expression increased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 8 from Chen et al., 2025
whole organism nppa expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 5 from Chen et al., 2025
heart contraction decreased rate of continuous process, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 5 from Chen et al., 2025
whole organism chrm2b expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
whole organism bmp4 expression increased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 8 from Chen et al., 2025
whole organism ntrk1 expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
cardiac ventricle myh7 expression spatial pattern, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 5 from Chen et al., 2025
heart linear, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 5 from Chen et al., 2025
whole organism wnt3 expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 8 from Chen et al., 2025
whole organism morphology, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 4 from Chen et al., 2025
whole organism p2rx3a expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
whole organism myh7 expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 5 from Chen et al., 2025
whole organism rac1l expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
whole organism itgae.1 expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
whole organism pla2g4aa expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
whole organism dvl2 expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 8 from Chen et al., 2025
whole organism pla2g4f.1 expression increased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
whole organism itpka expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
whole organism tbx5a expression increased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 8 from Chen et al., 2025
heart myl7 expression spatial pattern, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 5 from Chen et al., 2025
whole organism plcd1a expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
whole organism tbx2b expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 5 from Chen et al., 2025
whole organism ddx3xa expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 4 from Chen et al., 2025
whole organism wnt5b expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 8 from Chen et al., 2025
heart dorsal side tbx5a expression increased distribution, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 8 from Chen et al., 2025
atrium hypoplastic, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 5 from Chen et al., 2025
whole organism ntsr1 expression decreased amount, abnormal	ddx3xa^hn102/hn102 (AB)	standard conditions	FIGURE 7 from Chen et al., 2025
whole organism tbx5a expression amount, ameliorated	ddx3xa^hn102/hn102; hn1Tg (AB)	chemical treatment by environment: IWR-1-endo	FIGURE 9 from Chen et al., 2025
heart linear, abnormal	ddx3xa^hn102/hn102; hn1Tg (AB)	control	FIGURE 9 from Chen et al., 2025
heart morphology, ameliorated	ddx3xa^hn102/hn102; hn1Tg (AB)	chemical treatment by environment: IWR-1-endo	FIGURE 9 from Chen et al., 2025
whole organism nppb expression increased amount, abnormal	ddx3xa^hn102/hn102; hn1Tg (AB)	control	FIGURE 9 from Chen et al., 2025
whole organism tbx5a expression increased amount, abnormal	ddx3xa^hn102/hn102; hn1Tg (AB)	control	FIGURE 9 from Chen et al., 2025
whole organism nppb expression amount, ameliorated	ddx3xa^hn102/hn102; hn1Tg (AB)	chemical treatment by environment: IWR-1-endo	FIGURE 9 from Chen et al., 2025
cardiac ventricle size, ameliorated	ddx3xa^hn102/hn102; hn1Tg (AB)	chemical treatment by environment: IWR-1-endo	FIGURE 9 from Chen et al., 2025
atrium size, ameliorated	ddx3xa^hn102/hn102; hn1Tg (AB)	chemical treatment by environment: IWR-1-endo	FIGURE 9 from Chen et al., 2025
whole organism actn2b expression increased amount, abnormal	ddx3xa^hn102/hn102; hn1Tg (AB)	control	FIGURE 9 from Chen et al., 2025
pericardium edematous, abnormal	ddx3xa^hn102/hn102; hn1Tg (AB)	control	FIGURE 9 from Chen et al., 2025
whole organism bmp4 expression amount, ameliorated	ddx3xa^hn102/hn102; hn1Tg (AB)	chemical treatment by environment: IWR-1-endo	FIGURE 9 from Chen et al., 2025
atrium dilated, abnormal	ddx3xa^hn102/hn102; hn1Tg (AB)	control	FIGURE 9 from Chen et al., 2025
cardiac ventricle atrophied, abnormal	ddx3xa^hn102/hn102; hn1Tg (AB)	control	FIGURE 9 from Chen et al., 2025
pericardium composition, ameliorated	ddx3xa^hn102/hn102; hn1Tg (AB)	chemical treatment by environment: IWR-1-endo	FIGURE 9 from Chen et al., 2025
heart contraction rate of continuous process, ameliorated	ddx3xa^hn102/hn102; hn1Tg (AB)	chemical treatment by environment: IWR-1-endo	FIGURE 9 from Chen et al., 2025
heart contraction decreased rate of continuous process, abnormal	ddx3xa^hn102/hn102; hn1Tg (AB)	control	FIGURE 9 from Chen et al., 2025
whole organism bmp4 expression increased amount, abnormal	ddx3xa^hn102/hn102; hn1Tg (AB)	control	FIGURE 9 from Chen et al., 2025
whole organism actn2b expression amount, ameliorated	ddx3xa^hn102/hn102; hn1Tg (AB)	chemical treatment by environment: IWR-1-endo	FIGURE 9 from Chen et al., 2025

Citations