CRISPR

CRISPR6-myh9b

ID
ZDB-CRISPR-250429-15
Name
CRISPR6-myh9b
Previous Names
None
Target
Sequence
5' - GGGCCGGGACTACGTGCAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mke414 myh9b
Expression
Gene expression in Wild Types + CRISPR6-myh9b
No data available
Phenotype
Phenotype resulting from CRISPR6-myh9b
No data available
Phenotype of all Fish created by or utilizing CRISPR6-myh9b
Phenotype Fish Conditions Figures
whole organism myh9a expression decreased amount, abnormal myh9bmke414/mke414 standard conditions Fig. 5. with imageFig. 6. with image from Rolfs et al., 2024
whole organism viability, abnormal myh9bmke414/mke414 standard conditions Fig. 4. with image from Rolfs et al., 2024
pericardium edematous, abnormal myh9bmke414/mke414 standard conditions Fig. 3. with image from Rolfs et al., 2024
whole organism myh9b expression decreased amount, abnormal myh9bmke414/mke414 standard conditions Fig. 5. with image from Rolfs et al., 2024
whole organism myh9a expression decreased amount, abnormal myh9bmke414/+ standard conditions Fig. 5. with imageFig. 6. with image from Rolfs et al., 2024
whole organism myh9b expression decreased amount, abnormal myh9bmke414/+ standard conditions Fig. 5. with image from Rolfs et al., 2024
whole organism myh10 expression decreased amount, abnormal myh9bmke414/+ standard conditions Fig. 5. with image from Rolfs et al., 2024
extension decreased length, abnormal myh9asa20632/sa20632; myh9bmke414/mke414 standard conditions Fig. 7. with image from Rolfs et al., 2024
pericardium edematous, abnormal myh9asa20632/sa20632; myh9bmke414/mke414 standard conditions Fig. 7. with image from Rolfs et al., 2024
yolk edematous, abnormal myh9asa20632/sa20632; myh9bmke414/mke414 standard conditions Fig. 7. with image from Rolfs et al., 2024
whole organism cystic, abnormal myh9asa20632/sa20632; myh9bmke414/mke414 standard conditions Fig. 7. with image from Rolfs et al., 2024
integument blistered, abnormal myh9asa20632/sa20632; myh9bmke414/mke414 standard conditions Fig. 7. with image from Rolfs et al., 2024
pericardium edematous, abnormal myh10mke508/mke508; myh9bmke414/mke414 standard conditions Fig. 7. with image from Rolfs et al., 2024
yolk edematous, abnormal myh10mke508/mke508; myh9bmke414/mke414 standard conditions Fig. 7. with image from Rolfs et al., 2024
whole organism cystic, abnormal myh10mke508/mke508; myh9bmke414/mke414 standard conditions Fig. 7. with image from Rolfs et al., 2024
axis curved, abnormal myh10mke508/mke508; myh9bmke414/mke414 standard conditions Fig. 7. with image from Rolfs et al., 2024
male organism male sterile, abnormal myh10mke508/mke508; myh9bmke414/mke414 standard conditions Fig. 7. with image from Rolfs et al., 2024
multicellular organism development arrested, abnormal myh10mke508/mke508; myh9bmke414/mke414 standard conditions Fig. 7. with image from Rolfs et al., 2024
Citations