CRISPR

CRISPR4-wfs1b

ID

ZDB-CRISPR-240214-5

Name

CRISPR4-wfs1b

Previous Names

None

Target

wfs1b (1)

Sequence

5' - GGGGGCGGAGTCATGGCTGA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ah828	wfs1b

Expression

Gene expression in Wild Types + CRISPR4-wfs1b

No data available

Phenotype

Phenotype resulting from CRISPR4-wfs1b

No data available

Phenotype of all Fish created by or utilizing CRISPR4-wfs1b

Phenotype	Fish	Conditions	Figures
whole organism hspa5 expression increased amount, abnormal	wfs1b^ah828/ah828	standard conditions	Fig. 6 from Wang et al., 2022
whole organism hsp90b1 expression increased amount, abnormal	wfs1b^ah828/ah828	standard conditions	Fig. 6 from Wang et al., 2022
whole organism atf6 expression increased amount, abnormal	wfs1b^ah828/ah828	standard conditions	Fig. 6 from Wang et al., 2022
whole organism atf4a expression increased amount, abnormal	wfs1b^ah828/ah828	standard conditions	Fig. 6 from Wang et al., 2022
brain endoplasmic reticulum structure, abnormal	wfs1b^ah828/ah828	standard conditions	Fig. 6 from Wang et al., 2022
brain endoplasmic reticulum decreased perimeter, abnormal	wfs1b^ah828/ah828	standard conditions	Fig. 6 from Wang et al., 2022
brain endoplasmic reticulum decreased diameter, abnormal	wfs1b^ah828/ah828	standard conditions	Fig. 6 from Wang et al., 2022
brain endoplasmic reticulum decreased perimeter, abnormal	wfs1b^ah828/+	standard conditions	Fig. 6 from Wang et al., 2022
brain endoplasmic reticulum decreased diameter, abnormal	wfs1b^ah828/+	standard conditions	Fig. 6 from Wang et al., 2022
brain endoplasmic reticulum structure, abnormal	wfs1b^ah828/+	standard conditions	Fig. 6 from Wang et al., 2022
whole organism atf6 expression amount, ameliorated	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron, chemical treatment by environment: 4-phenylbutyric acid	Fig. 7 from Wang et al., 2022
whole organism hspa5 expression increased amount, abnormal	wfs1b^ah828/ah828; zf206Et	control	Fig. 7 from Wang et al., 2022
Mauthner neuron axon regeneration decreased process quality, abnormal	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron, chemical treatment by environment: tunicamycin	Fig. 7 from Wang et al., 2022
Mauthner neuron axon regeneration decreased rate of continuous process, abnormal	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron, chemical treatment by environment: tunicamycin	Fig. 7 from Wang et al., 2022
whole organism hsp90b1 expression increased amount, abnormal	wfs1b^ah828/ah828; zf206Et	control	Fig. 7 from Wang et al., 2022
whole organism atf6 expression increased amount, abnormal	wfs1b^ah828/ah828; zf206Et	control	Fig. 7 from Wang et al., 2022
swimming behavior decreased process quality, abnormal	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron	Fig. 4 from Wang et al., 2022
Mauthner neuron axon regeneration decreased rate of continuous process, abnormal	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron	Fig. 3 from Wang et al., 2022
Mauthner neuron axon regeneration process quality, ameliorated	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron, chemical treatment by environment: 4-phenylbutyric acid	Fig. 7 from Wang et al., 2022
Mauthner neuron axon regeneration rate of continuous process, ameliorated	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron, chemical treatment by environment: 4-phenylbutyric acid	Fig. 7 from Wang et al., 2022
behavioral fear response decreased process quality, abnormal	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron	Fig. 4 from Wang et al., 2022
whole organism hsp90b1 expression increased amount, abnormal	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron, chemical treatment by environment: tunicamycin	Fig. 7 from Wang et al., 2022
whole organism hsp90b1 expression amount, ameliorated	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron, chemical treatment by environment: 4-phenylbutyric acid	Fig. 7 from Wang et al., 2022
Mauthner neuron axon regeneration decreased rate of continuous process, abnormal	wfs1b^ah828/ah828; zf206Et	control	Fig. 7 from Wang et al., 2022
whole organism atf6 expression increased amount, abnormal	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron, chemical treatment by environment: tunicamycin	Fig. 7 from Wang et al., 2022
Mauthner neuron axon regeneration decreased process quality, abnormal	wfs1b^ah828/ah828; zf206Et	control	Fig. 7 from Wang et al., 2022
whole organism hspa5 expression increased amount, abnormal	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron, chemical treatment by environment: tunicamycin	Fig. 7 from Wang et al., 2022
whole organism hspa5 expression amount, ameliorated	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron, chemical treatment by environment: 4-phenylbutyric acid	Fig. 7 from Wang et al., 2022
Mauthner neuron axon regeneration decreased process quality, abnormal	wfs1b^ah828/ah828; zf206Et	light ablation: axon: Mauthner neuron	Fig. 3 from Wang et al., 2022

Citations