CRISPR

CRISPR1-ypel5

ID

ZDB-CRISPR-231109-16

Name

CRISPR1-ypel5

Previous Names

None

Target

ypel5 (1)

Sequence

5' - GGTGGCGCCGGTGAAGCGTG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
rj110	ypel5

Expression

Gene expression in Wild Types + CRISPR1-ypel5

No data available

Phenotype

Phenotype resulting from CRISPR1-ypel5

No data available

Phenotype of all Fish created by or utilizing CRISPR1-ypel5

Phenotype	Fish	Conditions	Figures
whole organism cfi expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
liver hnf4a expression amount, ameliorated	ypel5^rj110/rj110	chemical treatment by environment: bezafibrate	Figure 5 from Deng et al., 2023
whole organism apoa2 expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
whole organism fga expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
whole organism hnf4a expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 4 from Deng et al., 2023
whole organism apoea expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
whole organism apoa1a expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
whole organism apoeb expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
hepatocyte cell population proliferation increased occurrence, abnormal	ypel5^rj110/rj110	standard conditions	Figure 2 from Deng et al., 2023
whole organism cyp7a1 expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
whole organism cfh expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
liver increased size, abnormal	ypel5^rj110/rj110	standard conditions	Figure 1 , Figure 4 from Deng et al., 2023
whole organism fgb expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
whole organism cfb expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
whole organism dead, abnormal	ypel5^rj110/rj110	standard conditions	Figure 1 from Deng et al., 2023
whole organism fgg expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
whole organism serpinc1 expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023
whole organism ypel5 expression absent, abnormal	ypel5^rj110/rj110	standard conditions	Figure 1 from Deng et al., 2023
whole organism apoa1b expression decreased amount, abnormal	ypel5^rj110/rj110	standard conditions	Figure 3 , Figure 4 from Deng et al., 2023

Citations