CRISPR

CRISPR1-eng

ID

ZDB-CRISPR-231108-16

Name

CRISPR1-eng

Previous Names

None

Target

eng (1)

Sequence

5' - ACAGCAGATGCTCTTCATGTCGG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
ump11	eng

Expression

Gene expression in Wild Types + CRISPR1-eng

No data available

Phenotype

Phenotype resulting from CRISPR1-eng

No data available

Phenotype of all Fish created by or utilizing CRISPR1-eng

Phenotype	Fish	Conditions	Figures
whole organism egln3 expression increased amount, abnormal	eng^ump11/ump11 (AB)	standard conditions	Fig. 3. , Fig. 5. from Lelièvre et al., 2023
male organism increased ratio female organism, abnormal	eng^ump11/ump11 (AB)	control	Fig. 5. from Lelièvre et al., 2023
whole organism epoa expression increased amount, abnormal	eng^ump11/ump11 (AB)	chemical treatment by environment: phenylhydrazine	Fig. 5. from Lelièvre et al., 2023
whole organism viability, abnormal	eng^ump11/ump11 (AB)	control	Fig. 5. , Fig. 6. from Lelièvre et al., 2023
gill lamella decreased size, abnormal	eng^ump11/ump11 (AB)	standard conditions	Fig. 4. from Lelièvre et al., 2023
whole organism epoa expression increased amount, abnormal	eng^ump11/ump11 (AB)	standard conditions	Fig. 3. , Fig. 5. from Lelièvre et al., 2023
pharyngeal arch 4 artery increased size, abnormal	eng^ump11/ump11 (AB)	standard conditions	Fig. 4. from Lelièvre et al., 2023
male organism ratio female organism, ameliorated	eng^ump11/ump11 (AB)	chemical treatment by environment: phenylhydrazine	Fig. 5. from Lelièvre et al., 2023
whole organism nppa expression increased amount, abnormal	eng^ump11/ump11 (AB)	standard conditions	Fig. 3. , Fig. 5. from Lelièvre et al., 2023
whole organism nppa expression amount, ameliorated	eng^ump11/ump11 (AB)	chemical treatment by environment: phenylhydrazine	Fig. 5. from Lelièvre et al., 2023
whole organism nppb expression amount, ameliorated	eng^ump11/ump11 (AB)	chemical treatment by environment: phenylhydrazine	Fig. 5. from Lelièvre et al., 2023
whole organism viability, ameliorated	eng^ump11/ump11 (AB)	chemical treatment by environment: phenylhydrazine	Fig. 5. from Lelièvre et al., 2023
whole organism nppb expression increased amount, abnormal	eng^ump11/ump11 (AB)	standard conditions	Fig. 3. , Fig. 5. from Lelièvre et al., 2023
whole organism egln3 expression amount, ameliorated	eng^ump11/ump11 (AB)	chemical treatment by environment: phenylhydrazine	Fig. 5. from Lelièvre et al., 2023
efferent filamental artery decreased length, abnormal	eng^ump11/ump11; hu5333Tg; la116Tg (AB)	standard conditions	Fig. 4. from Lelièvre et al., 2023
efferent branchial artery increased size, abnormal	eng^ump11/ump11; hu5333Tg; la116Tg (AB)	standard conditions	Fig. 4. from Lelièvre et al., 2023
filamental artery decreased length, abnormal	eng^ump11/ump11; hu5333Tg; la116Tg (AB)	standard conditions	Fig. 4. from Lelièvre et al., 2023
efferent branchial artery increased diameter, abnormal	eng^ump11/ump11; hu5333Tg; la116Tg (AB)	standard conditions	Fig. 4. from Lelièvre et al., 2023
afferent filamental artery decreased length, abnormal	eng^ump11/ump11; hu5333Tg; la116Tg (AB)	standard conditions	Fig. 4. from Lelièvre et al., 2023
whole organism viability, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
pericardium edematous, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
male organism increased ratio female organism, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
dorsal aorta blood circulation increased rate of continuous process, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
whole organism low saturation, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
dorsal aorta dilated, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
cardiac ventricle increased size, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
posterior cardinal vein dilated, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
intersegmental vessel blood circulation decreased rate of continuous process, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
heart increased size, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
posterior cardinal vein blood circulation increased rate of continuous process, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
nucleate erythrocyte hemoglobin decreased amount, abnormal	eng^ump11/ump11; ko05Tg; la116Tg (AB)	standard conditions	Fig. 2. from Lelièvre et al., 2023
cardiac muscle cell increased amount, abnormal	eng^ump11/ump11; twu34Tg (AB)	standard conditions	Fig. 3. from Lelièvre et al., 2023
cardiac ventricle increased volume, abnormal	eng^ump11/ump11; twu34Tg (AB)	standard conditions	Fig. 3. from Lelièvre et al., 2023
whole organism viability, ameliorated	eng^ump11/ump11; ump12Tg (AB)	standard conditions	Fig. 6. from Lelièvre et al., 2023
whole organism viability, ameliorated	eng^ump11/ump11; ump13Tg (AB)	standard conditions	Fig. 6. from Lelièvre et al., 2023

Citations