CRISPR

CRISPR3-kars1

ID
ZDB-CRISPR-230602-1
Name
CRISPR3-kars1
Previous Names
None
Target
Sequence
5' - GGGAGACATCATCGGGGTCC - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
omf1 kars1
omf2 kars1
Expression
Gene expression in Wild Types + CRISPR3-kars1
No data available
Phenotype
Phenotype resulting from CRISPR3-kars1
No data available
Phenotype of all Fish created by or utilizing CRISPR3-kars1
Phenotype Fish Conditions Figures
pericardium edematous, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 2 with image from Lin et al., 2021
whole organism iars1 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
otolith decreased size, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
eye decreased volume, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
retina layer formation disrupted, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
eye apoptotic process increased occurrence, abnormal kars1omf1/omf1 (NHGRI-1) control Fig. 4 with image from Lin et al., 2021
posterior lateral line neuromast has fewer parts of type neuromast hair cell, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S8 from Lin et al., 2021
brain vacuolated, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
swim bladder uninflated, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 2 with image from Lin et al., 2021
inner ear has fewer parts of type inner ear stereocilium, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
inner ear apoptotic process increased occurrence, abnormal kars1omf1/omf1 (NHGRI-1) control Fig. 4 with image from Lin et al., 2021
whole organism gnb3b expression decreased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 4 with image,  Fig. S12 from Lin et al., 2021
whole organism tulp1b expression decreased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
whole organism kars1 expression decreased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S6 from Lin et al., 2021
whole organism tp53 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
whole organism qars1 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
whole organism hars expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
brain apoptotic process increased occurrence, abnormal kars1omf1/omf1 (NHGRI-1) control Fig. 4 with image from Lin et al., 2021
eye decreased size, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 2 with image,  Fig. 4 with image from Lin et al., 2021
motor neuron axon terminus decreased branchiness, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
whole organism aimp1b expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
whole organism dead, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 2 with image from Lin et al., 2021
brain spongy, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
whole organism aimp2 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
primary motor neuron axon decreased diameter, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
whole organism grk7a expression decreased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 4 with image,  Fig. S12 from Lin et al., 2021
whole organism fosab expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S8 from Lin et al., 2021
immature anterior macula flattened, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
whole organism mbpa expression decreased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 4 with image,  Fig. S12 from Lin et al., 2021
thigmotaxis arrested, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
motor neuron neuron projection decreased size, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
whole organism casp9 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 4 with image,  Fig. S12 from Lin et al., 2021
whole organism rbp2a expression decreased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
otic vesicle decreased size, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 2 with image,  Fig. 3 with image from Lin et al., 2021
head decreased size, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 2 with image from Lin et al., 2021
whole organism neurod2 expression decreased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
whole organism rars1 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
whole organism lars1b expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
brain segmentation disrupted, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
whole organism yars1 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
trunk apoptotic process increased occurrence, abnormal kars1omf1/omf1 (NHGRI-1) control Fig. 4 with image from Lin et al., 2021
retina morphology, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
startle response arrested, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 2 with image from Lin et al., 2021
whole organism neurod1 expression decreased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 4 with image,  Fig. S12 from Lin et al., 2021
brain has fewer parts of type neuron, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
whole organism eprs1 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
whole organism stxbp1b expression decreased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
immature posterior macula flattened, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
whole organism mars1 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
whole organism dars1 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
whole organism casp8 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 4 with image,  Fig. S12 from Lin et al., 2021
whole organism gars1 expression increased amount, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. S12 from Lin et al., 2021
trunk musculature muscle cell morphology, abnormal kars1omf1/omf1 (NHGRI-1) standard conditions Fig. 3 with image from Lin et al., 2021
otolith decreased size, abnormal kars1omf2/omf2 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
pericardium edematous, abnormal kars1omf2/omf2 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
swim bladder uninflated, abnormal kars1omf2/omf2 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
whole organism kars1 expression decreased amount, abnormal kars1omf2/omf2 (NHGRI-1) standard conditions Fig. S6 from Lin et al., 2021
eye decreased size, abnormal kars1omf2/omf2 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
whole organism dead, abnormal kars1omf2/omf2 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
head decreased size, abnormal kars1omf2/omf2 (NHGRI-1) standard conditions Fig. S7 from Lin et al., 2021
eye decreased size, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
whole organism viability, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
retina layer formation disrupted, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
brain vacuolated, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
brain spongy, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
head decreased size, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
eye decreased volume, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
retina morphology, abnormal NHGRI-1 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
inner ear apoptotic process occurrence, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
eye apoptotic process occurrence, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism gnb3b expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism casp8 expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism casp9 expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
eye size, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism neurod1 expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism mbpa expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
brain apoptotic process occurrence, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
trunk apoptotic process occurrence, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
whole organism grk7a expression amount, ameliorated kars1omf1/omf1 + MO4-tp53 (NHGRI-1) standard conditions Fig. 4 with image from Lin et al., 2021
head size, ameliorated NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
whole organism viability, ameliorated NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
brain structure, ameliorated NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
retina morphology, ameliorated NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
eye size, ameliorated NHGRI-1 + CRISPR19-tp53 + CRISPR20-tp53 + CRISPR21-tp53 + CRISPR3-kars1 + CRISPR4-kars1 + CRISPR5-kars1 + CRISPR6-kars1 + CRISPR7-kars1 standard conditions Fig. 4 with image from Lin et al., 2021
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.