CRISPR

CRISPR4-lrrk2

ID
ZDB-CRISPR-230208-2
Name
CRISPR4-lrrk2
Previous Names
None
Target
Sequence
5' - TGACAGGGAGTTGTCGATGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "CGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
tud113 lrrk2
Expression
Gene expression in Wild Types + CRISPR4-lrrk2
No data available
Phenotype
Phenotype resulting from CRISPR4-lrrk2
No data available
Phenotype of all Fish created by or utilizing CRISPR4-lrrk2
Phenotype Fish Conditions Figures
brain monoamine oxidase activity increased magnitude, abnormal lrrk2tud113/tud113 standard conditions Fig 4 with image from Suzzi et al., 2021
paraventricular organ ab1-th labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 3 with image from Suzzi et al., 2021
telencephalon ab1-th labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 3 with image from Suzzi et al., 2021
hindbrain cell death increased frequency, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
telencephalon cell death increased frequency, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
brain dopamine biosynthetic process decreased magnitude, abnormal lrrk2tud113/tud113 standard conditions Fig 4 with image from Suzzi et al., 2021
brain serotonin biosynthetic process decreased magnitude, abnormal lrrk2tud113/tud113 standard conditions Fig 4 with image from Suzzi et al., 2021
midbrain cell death increased frequency, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
olfactory bulb ab1-th labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 3 with image from Suzzi et al., 2021
telencephalon ab1-th labeling increased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 3 with image from Suzzi et al., 2021
microglial cell ab2-lcp1 labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
diencephalon ab1-th labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 3 with image from Suzzi et al., 2021
hindbrain commissure ab1-cldnk labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
hindbrain myelin sheath disorganized, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
leukocyte ab2-lcp1 labeling decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
diencephalon cell death increased frequency, abnormal lrrk2tud113/tud113 standard conditions Fig 2 with image from Suzzi et al., 2021
whole organism lrrk2 expression decreased amount, abnormal lrrk2tud113/tud113 standard conditions Fig 1 with image from Suzzi et al., 2021
Citations