CRISPR

CRISPR1-lrrk2,slc2a13b

ID

ZDB-CRISPR-230208-1

Previous Names

CRISPR4-lrrk2

Targets

lrrk2 (1)
slc2a13b (1)

Sequence

5' - GGGATGTTAATGTGTCAACA - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "TGG" at the 3 end.

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
tud113	lrrk2

Expression

Gene expression in Wild Types + CRISPR1-lrrk2,slc2a13b

No data available

Phenotype

Phenotype resulting from CRISPR1-lrrk2,slc2a13b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-lrrk2,slc2a13b

Phenotype	Fish	Conditions	Figures
brain monoamine oxidase activity increased magnitude, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 4 from Suzzi et al., 2021
paraventricular organ ab1-th labeling decreased amount, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 3 from Suzzi et al., 2021
telencephalon ab1-th labeling decreased amount, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 3 from Suzzi et al., 2021
hindbrain cell death increased frequency, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 2 from Suzzi et al., 2021
telencephalon cell death increased frequency, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 2 from Suzzi et al., 2021
brain dopamine biosynthetic process decreased magnitude, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 4 from Suzzi et al., 2021
brain serotonin biosynthetic process decreased magnitude, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 4 from Suzzi et al., 2021
midbrain cell death increased frequency, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 2 from Suzzi et al., 2021
olfactory bulb ab1-th labeling decreased amount, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 3 from Suzzi et al., 2021
telencephalon ab1-th labeling increased amount, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 3 from Suzzi et al., 2021
microglial cell ab2-lcp1 labeling decreased amount, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 2 from Suzzi et al., 2021
diencephalon ab1-th labeling decreased amount, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 3 from Suzzi et al., 2021
hindbrain commissure ab1-cldnk labeling decreased amount, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 2 from Suzzi et al., 2021
hindbrain myelin sheath disorganized, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 2 from Suzzi et al., 2021
leukocyte ab2-lcp1 labeling decreased amount, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 2 from Suzzi et al., 2021
diencephalon cell death increased frequency, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 2 from Suzzi et al., 2021
whole organism lrrk2 expression decreased amount, abnormal	lrrk2^{tud113/tud113}	standard conditions	Fig 1 from Suzzi et al., 2021

Citations