CRISPR

CRISPR1-ngly1

ID

ZDB-CRISPR-230104-1

Name

CRISPR1-ngly1

Previous Names

None

Target

ngly1 (1)

Sequence

5' - GGAGGACAGAAAACATGTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
zf3678	ngly1

Expression

Gene expression in Wild Types + CRISPR1-ngly1

No data available

Phenotype

Phenotype resulting from CRISPR1-ngly1

No data available

Phenotype of all Fish created by or utilizing CRISPR1-ngly1

Phenotype	Fish	Conditions	Figures
brain Ab11-app labeling increased distribution, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 4 from Mesika et al., 2025
swimming behavior increased process quality, abnormal	ngly1^{zf3678/zf3678} (AB)	chemical treatment by environment: acetic acid	Fig. 6 from Mesika et al., 2022
optic tectum Ab11-app labeling increased distribution, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 4 from Mesika et al., 2025
skeletal muscle cell increased distance skeletal muscle cell, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 1 from Mesika et al., 2025
eye aqp1a.1 expression decreased amount, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 2 from Mesika et al., 2025
brain ube3a expression decreased amount, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 3 from Mesika et al., 2025
periventricular grey zone neuron decreased amount, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 1 from Mesika et al., 2025
skeletal muscle cell decreased amount, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 1 from Mesika et al., 2025
optic tectum amyloid-beta complex increased distribution, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 4 from Mesika et al., 2025
swimming behavior increased process quality, abnormal	ngly1^{zf3678/zf3678} (AB)	lighting conditions	Fig. 6 from Mesika et al., 2022
lateral valvula cerebelli neuron decreased amount, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 1 from Mesika et al., 2025
brain amyloid-beta complex increased distribution, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 4 from Mesika et al., 2025
snout decreased length, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 1 from Mesika et al., 2025
skeletal muscle decreased mass, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	Fig. 5 from Mesika et al., 2022
brain ubb expression decreased amount, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 3 from Mesika et al., 2025
caudal fin Ab1-ngly1 labeling decreased amount, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	Fig. 3 from Mesika et al., 2022
brain mitochondrion fragmented, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 2 from Mesika et al., 2025
eye ab1-aqp1a.1 labeling decreased amount, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 2 from Mesika et al., 2025
periventricular grey zone Ab4-ubb labeling increased distribution, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 3 from Mesika et al., 2025
dentary increased angle to basihyal bone, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 1 from Mesika et al., 2025
caudal fin ngly1 expression decreased amount, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	Fig. 3 from Mesika et al., 2022
brain ab1-aqp1a.1 labeling decreased amount, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 2 from Mesika et al., 2025
swimming behavior decreased process quality, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	Fig. 6 from Mesika et al., 2022
swimming behavior decreased process quality, abnormal	ngly1^{zf3678/zf3678} (AB)	lighting conditions	Fig. 6 from Mesika et al., 2022
basihyal bone protruding, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 1 from Mesika et al., 2025
somite decreased size, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	Fig. 5 from Mesika et al., 2022
brain Ab4-ubb labeling increased amount, abnormal	ngly1^{zf3678/zf3678} (AB)	standard conditions	FIGURE 3 from Mesika et al., 2025
peripheral nervous system axon decreased distribution, abnormal	ngly1^{zf3678/zf3678}; mde4Tg; mde6Tg (AB)	standard conditions	Fig. 4 from Mesika et al., 2022
peripheral nervous system axon mYFP expression decreased distribution, abnormal	ngly1^{zf3678/zf3678}; mde4Tg; mde6Tg (AB)	standard conditions	Fig. 4 from Mesika et al., 2022

Citations