CRISPR

CRISPR1-epm2a

ID
ZDB-CRISPR-221219-2
Name
CRISPR1-epm2a
Previous Names
None
Target
Sequence
5' - GGAGCCGTGCCTGTGGACCG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
zf3794 epm2a
Expression
Gene expression in Wild Types + CRISPR1-epm2a
No data available
Phenotype
Phenotype resulting from CRISPR1-epm2a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-epm2a
Phenotype Fish Conditions Figures
whole organism il6 expression amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 3 with image from Della Vecchia et al., 2025
whole organism il1b expression increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 3 with image from Della Vecchia et al., 2025
whole organism il6 expression increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 3 with image from Della Vecchia et al., 2025
whole organism nlrp3 expression increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 3 with image from Della Vecchia et al., 2025
whole organism becn1 expression increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 4 with image from Della Vecchia et al., 2025
whole organism mtor expression amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 4 with image from Della Vecchia et al., 2025
whole organism sqstm1 expression amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 4 with image from Della Vecchia et al., 2025
whole organism il1b expression amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 3 with image from Della Vecchia et al., 2025
whole organism Ab2-lamp1 labeling amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 5 with image from Della Vecchia et al., 2025
whole organism tfeb expression increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 4 with image from Della Vecchia et al., 2025
swimming behavior occurrence, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: empagliflozin Fig. 1 with image from Della Vecchia et al., 2025
whole organism atg5 expression increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 4 with image from Della Vecchia et al., 2025
whole organism atg5 expression amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 4 with image from Della Vecchia et al., 2025
swimming decreased linear velocity, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 1 with image from Della Vecchia et al., 2025
whole organism decreased length, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 3 with image from Della Vecchia et al., 2025
swimming behavior increased occurrence, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 1 with image from Della Vecchia et al., 2025
swimming behavior occurrence, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 1 with image from Della Vecchia et al., 2025
whole organism sqstm1 expression increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 4 with image from Della Vecchia et al., 2025
whole organism atg12 expression increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 4 with image from Della Vecchia et al., 2025
brain Ab2-lamp1 labeling decreased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 5 with image from Della Vecchia et al., 2025
whole organism becn1 expression amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 4 with image from Della Vecchia et al., 2025
forebrain neuronal action potential magnitude, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 2 with image from Della Vecchia et al., 2025
whole organism reactive oxygen species increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 3 with image from Della Vecchia et al., 2025
whole organism tnfa expression increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 3 with image from Della Vecchia et al., 2025
whole organism Ab2-lamp1 labeling decreased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 5 with image from Della Vecchia et al., 2025
whole organism atg12 expression amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 4 with image from Della Vecchia et al., 2025
forebrain neuronal action potential increased duration, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 2 with image from Della Vecchia et al., 2025
whole organism reactive oxygen species amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 3 with image from Della Vecchia et al., 2025
whole organism decreased length, abnormal epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 3 with image from Della Vecchia et al., 2025
whole organism glycogen amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 3 with image from Della Vecchia et al., 2025
forebrain neuronal action potential increased magnitude, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 2 with image from Della Vecchia et al., 2025
brain Ab2-lamp1 labeling amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 5 with image from Della Vecchia et al., 2025
whole organism mtor expression increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 4 with image from Della Vecchia et al., 2025
whole organism map1lc3a expression increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 4 with image from Della Vecchia et al., 2025
forebrain neuronal action potential duration, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 2 with image from Della Vecchia et al., 2025
whole organism map1lc3a expression amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 4 with image from Della Vecchia et al., 2025
whole organism nlrp3 expression amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 3 with image from Della Vecchia et al., 2025
swimming behavior occurrence, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: canagliflozin Fig. 1 with image from Della Vecchia et al., 2025
swimming behavior increased occurrence, abnormal epm2azf3794/zf3794 (AB) chemical treatment by environment: empagliflozin Fig. 1 with image from Della Vecchia et al., 2025
whole organism tfeb expression amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 4 with image from Della Vecchia et al., 2025
whole organism glycogen increased amount, abnormal epm2azf3794/zf3794 (AB) standard conditions Fig. 3 with image from Della Vecchia et al., 2025
whole organism tnfa expression amount, ameliorated epm2azf3794/zf3794 (AB) chemical treatment by environment: dapagliflozin Fig. 3 with image from Della Vecchia et al., 2025
brain glycogen increased distribution, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 3 with image from Della Vecchia et al., 2022
whole organism tnfa expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 6 with image from Della Vecchia et al., 2022
whole organism atg12 expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 7 with image from Della Vecchia et al., 2022
whole organism mtor expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 7 with image from Della Vecchia et al., 2022
whole organism csf1ra expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 6 with image from Della Vecchia et al., 2022
whole organism decreased length, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 2 with image from Della Vecchia et al., 2022
forebrain action potential initiation increased process quality, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 4 with imageFig. 8 with image from Della Vecchia et al., 2022
whole organism atg5 expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 7 with image from Della Vecchia et al., 2022
whole organism il10 expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 6 with image from Della Vecchia et al., 2022
forebrain action potential initiation increased frequency, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 4 with image from Della Vecchia et al., 2022
whole organism p2ry12 expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 6 with image from Della Vecchia et al., 2022
whole organism map1lc3a expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 7 with image from Della Vecchia et al., 2022
whole organism sqstm1 expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 7 with image from Della Vecchia et al., 2022
whole organism hexb expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 6 with image from Della Vecchia et al., 2022
whole organism il1b expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 6 with image from Della Vecchia et al., 2022
whole organism increased concentration whole organism glycogen, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 3 with image from Della Vecchia et al., 2022
whole organism epm2a expression decreased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 2 with image from Della Vecchia et al., 2022
whole organism kcnj10b expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 6 with image from Della Vecchia et al., 2022
whole organism becn1 expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 7 with image from Della Vecchia et al., 2022
whole organism ab2-map1lc3 labeling increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 7 with image from Della Vecchia et al., 2022
whole organism tfeb expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 7 with image from Della Vecchia et al., 2022
locomotion process quality, ameliorated mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) chemical treatment by environment: trehalose Fig. 8 with image from Della Vecchia et al., 2022
apoptotic process increased process quality, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 6 with image from Della Vecchia et al., 2022
whole organism ab4-atg5 labeling increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 7 with image from Della Vecchia et al., 2022
whole organism gfap expression increased amount, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 6 with image from Della Vecchia et al., 2022
locomotion increased process quality, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 4 with imageFig. 8 with image from Della Vecchia et al., 2022
forebrain action potential initiation process quality, ameliorated mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) chemical treatment by environment: trehalose Fig. 8 with image from Della Vecchia et al., 2022
swimming behavior process quality, ameliorated mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) chemical treatment by environment: trehalose Fig. 8 with image from Della Vecchia et al., 2022
swimming behavior decreased process quality, abnormal mitfaw2/+; epm2azf3794/zf3794; icm05Tg (AB) standard conditions Fig. 5 with imageFig. 8 with image from Della Vecchia et al., 2022
Citations