CRISPR
CRISPR1-nccr.dlx5i6
- ID
- ZDB-CRISPR-221018-1
- Name
- CRISPR1-nccr.dlx5i6
- Previous Names
-
- CRISPR1-dlx6a
- Target
-
- nccr.dlx5i6 (1)
- Sequence
-
5' - GGGAGCCGGAATGGAGACAG - 3'
- Disclaimer
- Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
- Note
-
The PAM site was "TGG" at the 3' end.
- Genome Resources
- None
Target Location
Constructs
No data available
Genomic Features
| Genomic Feature | Affected Genomic Regions |
|---|---|
| Df(19:nccr.dlx5i6,en.inter56)ot504 | en.inter56, nccr.dlx5i6 |
Expression
Gene expression in Wild Types + CRISPR1-nccr.dlx5i6
No data available
Phenotype
Phenotype resulting from CRISPR1-nccr.dlx5i6
No data available
Phenotype of all Fish created by or utilizing CRISPR1-nccr.dlx5i6
Citations