CRISPR

CRISPR1-sv2a

ID
ZDB-CRISPR-221007-1
Name
CRISPR1-sv2a
Previous Names
None
Target
Sequence
5' - GTGGACCCTCTACTTTGTGC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "TGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
lv105 sv2a
Expression
Gene expression in Wild Types + CRISPR1-sv2a
No data available
Phenotype
Phenotype resulting from CRISPR1-sv2a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-sv2a
Phenotype Fish Conditions Figures
neuronal action potential propagation process quality, ameliorated sv2alv105/lv105 (AB) chemical treatment by environment: (5Z)-5-(quinoxalin-6-ylmethylidene)-1,3-thiazolidine-2,4-dione FIGURE 5 with image from Zhang et al., 2022
whole organism swimming behavior increased process quality, abnormal sv2alv105/lv105 (AB) standard conditions FIGURE 2 with image from Zhang et al., 2022
neuronal action potential propagation process quality, ameliorated sv2alv105/lv105 (AB) chemical treatment by environment: levetiracetam FIGURE 3 with image from Zhang et al., 2022
integument increased pigmentation, abnormal sv2alv105/lv105 (AB) standard conditions FIGURE 2 with image from Zhang et al., 2022
whole organism sv2a expression decreased amount, abnormal sv2alv105/lv105 (AB) standard conditions FIGURE 1 with image from Zhang et al., 2022
post-vent region curved, abnormal sv2alv105/lv105 (AB) standard conditions FIGURE 2 with image from Zhang et al., 2022
neuronal action potential propagation increased process quality, abnormal sv2alv105/lv105 (AB) control FIGURE 3 with imageFIGURE 5 with image from Zhang et al., 2022
neuronal action potential propagation process quality, ameliorated sv2alv105/lv105 (AB) chemical treatment by environment: alvocidib FIGURE 5 with image from Zhang et al., 2022
dorsal telencephalon nucleus decreased amount, abnormal sv2alv105/lv105 (AB) standard conditions FIGURE 3 with image from Zhang et al., 2022
whole organism decreased life span, abnormal sv2alv105/lv105 (AB) standard conditions FIGURE 2 with image from Zhang et al., 2022
neuronal action potential propagation process quality, ameliorated sv2alv105/lv105 (AB) chemical treatment by environment: sodium valproate FIGURE 3 with image from Zhang et al., 2022
whole organism dead, abnormal sv2alv105/lv105 (AB) standard conditions FIGURE 2 with image from Zhang et al., 2022
neuronal action potential propagation increased process quality, abnormal sv2alv105/lv105 (AB) chemical treatment by environment: 2-(2-amino-3-methoxyphenyl)chromen-4-one FIGURE 5 with image from Zhang et al., 2022
whole organism viability, abnormal sv2alv105/lv105 (AB) standard conditions FIGURE 2 with image from Zhang et al., 2022
swim bladder uninflated, abnormal sv2alv105/lv105 (AB) standard conditions FIGURE 2 with image from Zhang et al., 2022
whole organism sv2a expression decreased amount, abnormal sv2alv105/+ (AB) standard conditions FIGURE 1 with image from Zhang et al., 2022
Citations