CRISPR

CRISPR1-cyp4v2b

ID

ZDB-CRISPR-220921-1

Name

CRISPR1-cyp4v2b

Previous Names

CRISPR1-cyp4v7

Target

cyp4v2b (1)

Sequence

5' - CAGATGCTGCGCGCAAACAG - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

The PAM site was "AGG" at the 3' end,

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
hzu14	cyp4v2b

Expression

Gene expression in Wild Types + CRISPR1-cyp4v2b

No data available

Phenotype

Phenotype resulting from CRISPR1-cyp4v2b

No data available

Phenotype of all Fish created by or utilizing CRISPR1-cyp4v2b

Phenotype	Fish	Conditions	Figures
whole organism cyp4v2b expression decreased amount, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 1 from Gao et al., 2022
photoreceptor outer segment layer decreased thickness, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 2 from Gao et al., 2022
retinal pigmented epithelium cell shape, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 3 from Gao et al., 2022
retinal pigmented epithelium lipid droplet present, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 4 from Gao et al., 2022
whole organism ab2-gnat2 labeling decreased amount, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 2 from Gao et al., 2022
whole organism hacl1 expression decreased amount, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 5 from Gao et al., 2022
whole organism fads2 expression decreased amount, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 5 from Gao et al., 2022
whole organism apoa1a expression decreased amount, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 5 from Gao et al., 2022
whole organism acsl1a expression decreased amount, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 5 from Gao et al., 2022
whole organism fabp4a expression decreased amount, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 5 from Gao et al., 2022
retinal pigmented epithelium cell degenerate, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 3 from Gao et al., 2022
retinal photoreceptor layer degenerate, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 2 from Gao et al., 2022
whole organism fabp7a expression decreased amount, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 5 from Gao et al., 2022
whole organism gnat1 expression decreased amount, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 2 from Gao et al., 2022
whole organism cyp27a1.2 expression decreased amount, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 5 from Gao et al., 2022
whole organism Ab6-ppara labeling decreased amount, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. 5 from Gao et al., 2022
retinal pigmented epithelium cholesterol present, abnormal	cyp4v2a^hzu15/hzu15; cyp4v2b^hzu14/hzu14	standard conditions	Fig. S3 from Gao et al., 2022

Citations