CRISPR

CRISPR2-npc2.1

ID
ZDB-CRISPR-220302-2
Name
CRISPR2-npc2.1
Previous Names
None
Target
Sequence
5' - GGTAGACGGAAAAGTAGTTC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
waw302 npc2.1
Expression
Gene expression in Wild Types + CRISPR2-npc2.1
No data available
Phenotype
Phenotype resulting from CRISPR2-npc2.1
No data available
Phenotype of all Fish created by or utilizing CRISPR2-npc2.1
Phenotype Fish Conditions Figures
cerebellum Purkinje cell distributed, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 6 with image,  FIGURE 7 with image from Wiweger et al., 2021
brain mpz expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 8 with image from Wiweger et al., 2021
olfactory bulb vacuolated, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 7 with image from Wiweger et al., 2021
liver npc2.1 expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 1 with image from Wiweger et al., 2021
whole organism mpeg1.1 expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 10 with image from Wiweger et al., 2021
liver calcium ion homeostasis process characteristic, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
pancreatic acinar cell zymogen granule absent, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 5 with image from Wiweger et al., 2021
whole organism olig1 expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 8 with image from Wiweger et al., 2021
liver mpx expression increased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
habenular commissure myelination decreased process quality, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 6 with image from Wiweger et al., 2021
brain myelination decreased process quality, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 8 with image from Wiweger et al., 2021
brain il1b expression increased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
liver il1b expression increased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
hepatocyte increased accumulation hepatocyte lipid droplet, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 5 with image from Wiweger et al., 2021
liver inflammatory response increased process quality, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
whole organism locomotory behavior decreased process quality, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 4 with image from Wiweger et al., 2021
whole organism lgals3a expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 10 with image from Wiweger et al., 2021
habenula structure, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 6 with image from Wiweger et al., 2021
cerebellum Purkinje cell structure, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 7 with image from Wiweger et al., 2021
midbrain vacuolated, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 6 with image from Wiweger et al., 2021
brain mbpa expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 8 with image from Wiweger et al., 2021
brain mpeg1.1 expression increased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
liver apoea expression increased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
raphe nucleus vacuolated, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 6 with image from Wiweger et al., 2021
pancreatic acinar cell cholesterol increased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 5 with image from Wiweger et al., 2021
telencephalon vacuolated, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 7 with image from Wiweger et al., 2021
whole organism il1b expression decreased amount, abnormal npc2.1waw302/waw302 (TL) chemical treatment: beta-cyclodextrin FIGURE 10 with image from Wiweger et al., 2021
whole organism decreased weight, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 1 with image from Wiweger et al., 2021
brain inflammatory response increased process quality, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
pancreatic acinar cell inclusion body increased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 5 with image from Wiweger et al., 2021
hepatocyte nucleus increased size, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 5 with image from Wiweger et al., 2021
interpeduncular nucleus tegmentum vacuolated, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 6 with image from Wiweger et al., 2021
whole organism capn2a expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 10 with image from Wiweger et al., 2021
liver ppp3ca expression increased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
lateral longitudinal fasciculus degeneration, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 6 with image from Wiweger et al., 2021
heart npc2.1 expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 1 with image from Wiweger et al., 2021
whole organism apoea expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 10 with image from Wiweger et al., 2021
brain capn2a expression increased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
whole organism myelination decreased process quality, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 8 with image from Wiweger et al., 2021
peripheral olfactory organ accumulation peripheral olfactory organ nile blue A, ameliorated npc2.1waw302/waw302 (TL) chemical treatment: beta-cyclodextrin FIGURE 3 with image from Wiweger et al., 2021
fasciculus retroflexus vacuolated, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 6 with image from Wiweger et al., 2021
whole organism ppp3ca expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 10 with image from Wiweger et al., 2021
whole organism mbpa expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 8 with image from Wiweger et al., 2021
whole organism cldnk expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 8 with image from Wiweger et al., 2021
cranial nerve II vacuolated, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 7 with image from Wiweger et al., 2021
kidney cell degeneration, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 5 with image from Wiweger et al., 2021
whole organism thigmotaxis increased process quality, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 4 with image from Wiweger et al., 2021
whole organism decreased length, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 1 with image from Wiweger et al., 2021
cranial nerve I degeneration, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 7 with image from Wiweger et al., 2021
whole organism mcu expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 10 with image from Wiweger et al., 2021
brain nfkb2 expression increased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
gonad npc2.1 expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 1 with image from Wiweger et al., 2021
spleen npc2.1 expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 1 with image from Wiweger et al., 2021
midbrain myelination decreased process quality, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 6 with image from Wiweger et al., 2021
hindbrain degeneration, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 7 with image from Wiweger et al., 2021
optic tectum vacuolated, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 7 with image from Wiweger et al., 2021
medial longitudinal fasciculus degeneration, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 6 with image from Wiweger et al., 2021
brain calcium ion homeostasis process characteristic, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 9 with image from Wiweger et al., 2021
peripheral olfactory organ increased accumulation peripheral olfactory organ nile blue A, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 2 with image,  FIGURE 3 with image from Wiweger et al., 2021
habenula vacuolated, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 6 with image from Wiweger et al., 2021
whole organism plp1b expression decreased amount, abnormal npc2.1waw302/waw302 (TL) standard conditions FIGURE 8 with image from Wiweger et al., 2021
optic tectum microglial cell circular, abnormal zh901Tg/zh901Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 standard conditions Fig. 1 with image from Zareba et al., 2024
microglial cell cell projection decreased amount, abnormal zh901Tg/zh901Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell mCherry expression spatial pattern, abnormal zh901Tg/zh901Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 standard conditions Fig. 1 with image from Zareba et al., 2024
microglial cell cell projection decreased amount, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell mCherry expression spatial pattern, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum phagocytic vesicle increased size, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 standard conditions Fig. 2 with image from Zareba et al., 2024
hindbrain microglial cell mCherry expression spatial pattern, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 standard conditions Fig. 2 with image from Zareba et al., 2024
optic tectum microglial cell circular, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 standard conditions Fig. 1 with image from Zareba et al., 2024
microglial cell cell projection decreased amount, abnormal zh901Tg/zh901Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell mCherry expression spatial pattern, abnormal zh901Tg/zh901Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell circular, abnormal zh901Tg/zh901Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell mCherry expression spatial pattern, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
optic tectum microglial cell circular, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
microglial cell cell projection decreased amount, abnormal i149Tg/i149Tg; i186Tg/i186Tg + CRISPR1-npc2.1 + CRISPR2-npc2.1 + CRISPR6-npc1 + CRISPR7-npc1 + CRISPR8-npc1 standard conditions Fig. 1 with image from Zareba et al., 2024
Citations