CRISPR

CRISPR2-npc2.1

ID

ZDB-CRISPR-220302-2

Name

CRISPR2-npc2.1

Previous Names

None

Target

npc2.1 (1)

Sequence

5' - GGTAGACGGAAAAGTAGTTC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
waw302	npc2.1

Expression

Gene expression in Wild Types + CRISPR2-npc2.1

No data available

Phenotype

Phenotype resulting from CRISPR2-npc2.1

No data available

Phenotype of all Fish created by or utilizing CRISPR2-npc2.1

Phenotype	Fish	Conditions	Figures
cerebellum Purkinje cell distributed, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 6 , FIGURE 7 from Wiweger et al., 2021
brain mpz expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 8 from Wiweger et al., 2021
olfactory bulb vacuolated, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 7 from Wiweger et al., 2021
liver npc2.1 expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 1 from Wiweger et al., 2021
whole organism mpeg1.1 expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 10 from Wiweger et al., 2021
pancreatic acinar cell zymogen granule absent, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 5 from Wiweger et al., 2021
whole organism olig1 expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 8 from Wiweger et al., 2021
liver mpx expression increased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
habenular commissure myelination decreased process quality, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 6 from Wiweger et al., 2021
brain myelination decreased process quality, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 8 from Wiweger et al., 2021
brain il1b expression increased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
liver il1b expression increased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
hepatocyte increased accumulation hepatocyte lipid droplet, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 5 from Wiweger et al., 2021
liver inflammatory response increased process quality, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
whole organism locomotory behavior decreased process quality, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 4 from Wiweger et al., 2021
whole organism lgals3a expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 10 from Wiweger et al., 2021
habenula structure, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 6 from Wiweger et al., 2021
cerebellum Purkinje cell structure, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 7 from Wiweger et al., 2021
midbrain vacuolated, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 6 from Wiweger et al., 2021
brain mpeg1.1 expression increased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
brain mbpa expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 8 from Wiweger et al., 2021
liver apoea expression increased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
raphe nucleus vacuolated, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 6 from Wiweger et al., 2021
pancreatic acinar cell cholesterol increased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 5 from Wiweger et al., 2021
telencephalon vacuolated, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 7 from Wiweger et al., 2021
whole organism il1b expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	chemical treatment: beta-cyclodextrin	FIGURE 10 from Wiweger et al., 2021
whole organism decreased weight, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 1 from Wiweger et al., 2021
brain inflammatory response increased process quality, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
pancreatic acinar cell inclusion body increased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 5 from Wiweger et al., 2021
hepatocyte nucleus increased size, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 5 from Wiweger et al., 2021
interpeduncular nucleus tegmentum vacuolated, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 6 from Wiweger et al., 2021
whole organism capn2a expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 10 from Wiweger et al., 2021
liver ppp3ca expression increased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
lateral longitudinal fasciculus degeneration, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 6 from Wiweger et al., 2021
heart npc2.1 expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 1 from Wiweger et al., 2021
brain capn2a expression increased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
whole organism apoea expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 10 from Wiweger et al., 2021
whole organism myelination decreased process quality, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 8 from Wiweger et al., 2021
liver calcium ion homeostasis process quality, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
peripheral olfactory organ accumulation peripheral olfactory organ nile blue A, ameliorated	npc2.1^{waw302/waw302} (TL)	chemical treatment: beta-cyclodextrin	FIGURE 3 from Wiweger et al., 2021
fasciculus retroflexus vacuolated, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 6 from Wiweger et al., 2021
whole organism ppp3ca expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 10 from Wiweger et al., 2021
whole organism mbpa expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 8 from Wiweger et al., 2021
whole organism cldnk expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 8 from Wiweger et al., 2021
cranial nerve II vacuolated, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 7 from Wiweger et al., 2021
kidney cell degeneration, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 5 from Wiweger et al., 2021
whole organism decreased length, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 1 from Wiweger et al., 2021
whole organism thigmotaxis increased process quality, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 4 from Wiweger et al., 2021
cranial nerve I degeneration, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 7 from Wiweger et al., 2021
whole organism mcu expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 10 from Wiweger et al., 2021
brain nfkb2 expression increased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
gonad npc2.1 expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 1 from Wiweger et al., 2021
spleen npc2.1 expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 1 from Wiweger et al., 2021
midbrain myelination decreased process quality, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 6 from Wiweger et al., 2021
hindbrain degeneration, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 7 from Wiweger et al., 2021
brain calcium ion homeostasis process quality, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 9 from Wiweger et al., 2021
optic tectum vacuolated, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 7 from Wiweger et al., 2021
medial longitudinal fasciculus degeneration, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 6 from Wiweger et al., 2021
peripheral olfactory organ increased accumulation peripheral olfactory organ nile blue A, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 2 , FIGURE 3 from Wiweger et al., 2021
habenula vacuolated, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 6 from Wiweger et al., 2021
whole organism plp1b expression decreased amount, abnormal	npc2.1^{waw302/waw302} (TL)	standard conditions	FIGURE 8 from Wiweger et al., 2021

Citations