CRISPR

CRISPR1-stc1l

ID
ZDB-CRISPR-220125-4
Name
CRISPR1-stc1l
Previous Names
  • CRISPR1-stc1l,rhobtb2b
Target
Sequence
5' - GCAGAGCGCCATTCAGACAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
This CRISPR also appears to target the rhobtb2b-202 transcript in Ensembl. However Ensembl database does not support/predict the presence of T202 transcript. It only supports/predict the expression of shorter rhobtb2b transcript (T201), which didn?t share sequence with slc1a).
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
mi610 stc1l
mi611 stc1l
mi612 stc1l
Expression
Gene expression in Wild Types + CRISPR1-stc1l
No data available
Phenotype
Phenotype resulting from CRISPR1-stc1l
No data available
Phenotype of all Fish created by or utilizing CRISPR1-stc1l
Phenotype Fish Conditions Figures
heart normal object quality, ameliorated stc1lmi610/mi610 chemical treatment by environment: BMS-754807 FIGURE 6 with image from Li et al., 2021
whole organism edematous, abnormal stc1lmi610/mi610 chemical treatment by environment: dimethyl sulfoxide FIGURE 6 with image from Li et al., 2021
whole organism dead, abnormal stc1lmi610/mi610 chemical treatment by environment: dimethyl sulfoxide FIGURE 6 with image from Li et al., 2021
heart normal object quality, ameliorated stc1lmi610/mi610 chemical treatment by environment: sirolimus FIGURE 6 with image from Li et al., 2021
whole organism dead, abnormal stc1lmi610/mi610 standard conditions FIGURE 2 with imageFIGURE 6 with image from Li et al., 2021
whole organism pappaa expression increased amount, abnormal stc1lmi610/mi610 standard conditions FIGURE 4 with image from Li et al., 2021
whole organism edematous, abnormal stc1lmi610/mi610 standard conditions FIGURE 2 with image from Li et al., 2021
swim bladder uninflated, abnormal stc1lmi610/mi610 standard conditions FIGURE 2 with image from Li et al., 2021
NaK ionocyte increased amount, abnormal stc1lmi610/mi610 standard conditions FIGURE 3 with image from Li et al., 2021
heart edematous, abnormal stc1lmi610/mi610 standard conditions FIGURE 2 with imageFIGURE 6 with image from Li et al., 2021
whole organism calcium ion homeostasis decreased process quality, abnormal stc1lmi610/mi610 standard conditions FIGURE 3 with image from Li et al., 2021
whole organism edematous, abnormal stc1lmi611/mi611 standard conditions FIGURE 2 with image from Li et al., 2021
whole organism dead, abnormal stc1lmi611/mi611 standard conditions FIGURE 2 with imageFIGURE 6 with image from Li et al., 2021
NaK ionocyte increased amount, abnormal stc1lmi611/mi611 standard conditions FIGURE 3 with image from Li et al., 2021
heart edematous, abnormal stc1lmi611/mi611 standard conditions FIGURE 2 with imageFIGURE 6 with image from Li et al., 2021
swim bladder uninflated, abnormal stc1lmi611/mi611 standard conditions FIGURE 2 with image from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated stc1lmi610/mi610; mi602Tg chemical treatment by environment: BMS-754807 FIGURE 5 with image from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal stc1lmi610/mi610; mi602Tg chemical treatment by environment: dimethyl sulfoxide FIGURE 5 with image from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated stc1lmi610/mi610; mi602Tg chemical treatment by environment: MK-2206 FIGURE 5 with image from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal stc1lmi610/mi610; mi602Tg chemical treatment by environment: U0126 FIGURE 5 with image from Li et al., 2021
yolk syncytial layer ab2-akt labeling increased amount, abnormal stc1lmi610/mi610; mi602Tg standard conditions FIGURE 5 with image from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal stc1lmi610/mi610; mi602Tg standard conditions FIGURE 3 with imageFIGURE 4 with image from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated stc1lmi610/mi610; mi602Tg chemical treatment by environment: sirolimus FIGURE 5 with image from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated stc1lmi610/mi610; mi602Tg chemical treatment by environment: wortmannin FIGURE 5 with image from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal stc1lmi611/mi611; mi602Tg chemical treatment by environment: U0126 FIGURE 5 with image from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal stc1lmi611/mi611; mi602Tg chemical treatment by environment: dimethyl sulfoxide FIGURE 5 with image from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated stc1lmi611/mi611; mi602Tg chemical treatment by environment: sirolimus FIGURE 5 with image from Li et al., 2021
NaK ionocyte GFP expression increased amount, abnormal stc1lmi611/mi611; mi602Tg standard conditions FIGURE 4 with image from Li et al., 2021
NaK ionocyte GFP expression amount, ameliorated stc1lmi611/mi611; mi602Tg chemical treatment by environment: BMS-754807 FIGURE 5 with image from Li et al., 2021
heart normal object quality, ameliorated igfbp5ami607/mi607; stc1lmi610/mi610 standard conditions FIGURE 6 with image from Li et al., 2021
heart normal object quality, ameliorated pappaap170/p170; stc1lmi611/mi611 standard conditions FIGURE 6 with image from Li et al., 2021
NaK ionocyte GFP expression decreased amount, abnormal pappaap170/p170; stc1lmi611/mi611; mi602Tg standard conditions FIGURE 4 with image from Li et al., 2021
Citations