CRISPR

CRISPR1-stag1a

ID
ZDB-CRISPR-210819-1
Name
CRISPR1-stag1a
Previous Names
None
Target
Sequence
5' - GGGCTTTATGGCAGTCCAGA - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "GGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nz204 stag1a
Expression
Gene expression in Wild Types + CRISPR1-stag1a
No data available
Phenotype
Phenotype resulting from CRISPR1-stag1a
No data available
Phenotype of all Fish created by or utilizing CRISPR1-stag1a
Phenotype Fish Conditions Figures
anterior lateral mesoderm runx1 expression spatial pattern, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 6 with image from Ketharnathan et al., 2020
whole organism tal1 expression increased amount, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 4 with image from Ketharnathan et al., 2020
anterior lateral mesoderm runx1 expression increased distribution, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 6 with image from Ketharnathan et al., 2020
posterior lateral mesoderm tal1 expression spatial pattern, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 5 with image from Ketharnathan et al., 2020
posterior lateral mesoderm lateral side tal1 expression increased distribution, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 4 with image from Ketharnathan et al., 2020
anterior lateral mesoderm tal1 expression spatial pattern, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 6 with image from Ketharnathan et al., 2020
posterior lateral mesoderm runx1 expression increased distribution, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 4 with image from Ketharnathan et al., 2020
whole organism stag1a expression decreased amount, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 2 with image from Ketharnathan et al., 2020
anterior lateral mesoderm spi1b expression spatial pattern, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 6 with image from Ketharnathan et al., 2020
posterior lateral mesoderm lateral side tal1 expression spatial pattern, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 4 with image from Ketharnathan et al., 2020
posterior lateral mesoderm runx1 expression spatial pattern, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 4 with image from Ketharnathan et al., 2020
myeloid cell development increased process quality, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
posterior lateral mesoderm pax2a expression decreased amount, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 5 with image from Ketharnathan et al., 2020
anterior lateral mesoderm tal1 expression increased distribution, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 6 with image from Ketharnathan et al., 2020
erythroid lineage cell gata1a expression decreased amount, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
anterior lateral mesoderm spi1b expression increased distribution, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 6 with image from Ketharnathan et al., 2020
myeloid cell spi1b expression increased amount, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
erythroid lineage cell decreased amount, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
whole organism gata1a expression increased amount, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 4 with image from Ketharnathan et al., 2020
whole organism stag2b expression decreased amount, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 2 with image from Ketharnathan et al., 2020
whole organism gata1a expression decreased amount, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
whole organism stag1b expression decreased amount, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 2 with image from Ketharnathan et al., 2020
posterior lateral mesoderm tal1 expression increased distribution, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 5 with image from Ketharnathan et al., 2020
myeloid cell increased amount, abnormal stag1anz204/nz204 (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
erythroid lineage cell decreased amount, abnormal stag1anz204/+ (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
myeloid cell development increased process quality, abnormal stag1anz204/+ (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
erythroid lineage cell gata1a expression decreased amount, abnormal stag1anz204/+ (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
myeloid cell spi1b expression increased amount, abnormal stag1anz204/+ (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
myeloid cell increased amount, abnormal stag1anz204/+ (WIK) standard conditions Figure 3 with image from Ketharnathan et al., 2020
Citations