CRISPR

CRISPR2-sbds

ID
ZDB-CRISPR-210413-2
Name
CRISPR2-sbds
Previous Names
None
Target
Sequence
5' - AAGACCTATCCAATGCTTTTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nu132 sbds
nu167 sbds
Expression
Gene expression in Wild Types + CRISPR2-sbds
No data available
Phenotype
Phenotype resulting from CRISPR2-sbds
No data available
Phenotype of all Fish created by or utilizing CRISPR2-sbds
Phenotype Fish Conditions Figures
blood vessel decreased accumulation blood vessel lipid, abnormal sbdsnu132/nu132 standard conditions Fig. 4 with image from Oyarbide et al., 2020
whole organism sbds expression decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 1 from Oyarbide et al., 2020
whole organism casp9 expression increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5 from Oyarbide et al., 2020
intestinal villus decreased length, abnormal sbdsnu132/nu132 standard conditions Fig. 3 with image from Oyarbide et al., 2020
whole organism baxa expression increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5 from Oyarbide et al., 2020
pancreas PCNA complex decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 3 with image from Oyarbide et al., 2020
whole organism pparg expression increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 4 with image from Oyarbide et al., 2020
liver PCNA complex decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 3 with image from Oyarbide et al., 2020
whole organism decreased length, abnormal sbdsnu132/nu132 standard conditions Fig. 1,  Fig. 2 with image,  Fig. 6 with image from Oyarbide et al., 2020
whole organism srebf1 expression increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 4 with image from Oyarbide et al., 2020
whole organism Ab1-rps3 labeling decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5 from Oyarbide et al., 2020
whole organism dead, abnormal sbdsnu132/nu132 standard conditions Fig. 2 with image from Oyarbide et al., 2020
pancreas cell population proliferation decreased process quality, abnormal sbdsnu132/nu132 standard conditions Fig. 3 with image from Oyarbide et al., 2020
whole organism bbc3 expression increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5 from Oyarbide et al., 2020
whole organism cdkn1a expression increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5,  Fig. 6 with image from Oyarbide et al., 2020
whole organism ccng1 expression increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5 from Oyarbide et al., 2020
whole organism decreased length, abnormal sbdsnu132/nu132 fasting Fig. 6 with image from Oyarbide et al., 2020
whole organism Ab2-rpl5 labeling decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5 from Oyarbide et al., 2020
whole organism cdkn1a expression increased amount, abnormal sbdsnu132/nu132 fasting Fig. 6 with image from Oyarbide et al., 2020
liver ab7-pcna labeling decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 3 with image from Oyarbide et al., 2020
pancreas zymogen granule decreased size, abnormal sbdsnu132/nu132 standard conditions Fig. 3 with image from Oyarbide et al., 2020
whole organism cytosolic ribosome decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 1 from Oyarbide et al., 2020
whole organism tp53 expression increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5,  Fig. 6 with image from Oyarbide et al., 2020
whole organism Ab1-eif6 labeling increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5 from Oyarbide et al., 2020
liver fibrotic, abnormal sbdsnu132/nu132 standard conditions Fig. 3 with image from Oyarbide et al., 2020
acinar cell nucleus decreased size, abnormal sbdsnu132/nu132 standard conditions Fig. 3 with image from Oyarbide et al., 2020
pancreas zymogen granule decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 3 with image from Oyarbide et al., 2020
whole organism decreased life span, abnormal sbdsnu132/nu132 standard conditions Fig. 2 with image from Oyarbide et al., 2020
whole organism Ab3-rpl11 labeling decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5 from Oyarbide et al., 2020
whole organism mdm2 expression increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5 from Oyarbide et al., 2020
whole organism cdkn2a/b expression increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5 from Oyarbide et al., 2020
whole organism fasn expression increased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 4 with image from Oyarbide et al., 2020
whole organism lipid metabolic process increased process quality, abnormal sbdsnu132/nu132 standard conditions Fig. 4 with image from Oyarbide et al., 2020
intestine decreased accumulation intestine lipid droplet, abnormal sbdsnu132/nu132 standard conditions Fig. 4 with image from Oyarbide et al., 2020
caudal fin fin regeneration decreased process quality, abnormal sbdsnu132/nu132 amputation: caudal fin Fig. 2 with image from Oyarbide et al., 2020
pancreas ab7-pcna labeling decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 3 with image from Oyarbide et al., 2020
whole organism Ab1-sbds labeling decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 1 from Oyarbide et al., 2020
whole organism Ab1-rpl26 labeling decreased amount, abnormal sbdsnu132/nu132 standard conditions Fig. 5 from Oyarbide et al., 2020
liver cell population proliferation decreased process quality, abnormal sbdsnu132/nu132 standard conditions Fig. 3 with image from Oyarbide et al., 2020
whole organism decreased length, abnormal sbdsnu167/nu167 standard conditions Fig. 2 with image from Oyarbide et al., 2020
whole organism Ab1-eif6 labeling increased amount, abnormal sbdsnu167/nu167 standard conditions Fig. 1 from Oyarbide et al., 2020
whole organism Ab1-sbds labeling decreased amount, abnormal sbdsnu167/nu167 standard conditions Fig. 1 from Oyarbide et al., 2020
whole organism cytosolic ribosome decreased amount, abnormal sbdsnu132/+ standard conditions Fig. 1 from Oyarbide et al., 2020
whole organism neutrophil decreased amount, abnormal sbdsnu132/nu132; uwm4Tg standard conditions Fig. 2 with image from Oyarbide et al., 2020
whole organism life span, ameliorated sbdsnu132/nu132; zf3436Tg standard conditions Fig. 2 with image,  text only from Oyarbide et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.