CRISPR

CRISPR3-e2f5

ID
ZDB-CRISPR-201005-2
Name
CRISPR3-e2f5
Previous Names
None
Target
Sequence
5' - GGGTGACGAACTTGACTGTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ouc2019 e2f5
ouc2020 e2f5
ouc2021 e2f5
Expression
Gene expression in Wild Types + CRISPR3-e2f5
No data available
Phenotype
Phenotype resulting from CRISPR3-e2f5
No data available
Phenotype of all Fish created by or utilizing CRISPR3-e2f5
Phenotype Fish Conditions Figures
testis apoptotic process increased occurrence, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 2 with image from Xie et al., 2020
pronephric duct foxj1b expression decreased distribution, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 6 with image from Xie et al., 2020
spermatocyte meiotic prophase I arrested, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 2 with image from Xie et al., 2020
olfactory pit multi-ciliated epithelial cell absent, abnormal e2f5ouc2019/ouc2019 standard conditions Fig. S5 from Xie et al., 2020
pronephric tubule multi-ciliated epithelial cell rfx2 expression decreased distribution, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 6 with image from Xie et al., 2020
pronephric tubule renal principal cell rfx2 expression spatial pattern, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 6 with image from Xie et al., 2020
female sex determination disrupted, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 1 with image,  Fig. S1 from Xie et al., 2020
spermatocyte decreased amount, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 1 with image from Xie et al., 2020
meiosis I disrupted, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 2 with image from Xie et al., 2020
testis translucent, abnormal e2f5ouc2019/ouc2019 standard conditions Fig. S1 from Xie et al., 2020
pronephric duct jag2b expression decreased distribution, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 6 with image from Xie et al., 2020
female organism absent, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 1 with image,  Fig. S1 from Xie et al., 2020
pronephric duct rfx2 expression decreased distribution, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 6 with image from Xie et al., 2020
male organism decreased male fertility, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 1 with image from Xie et al., 2020
spermatid decreased amount, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 1 with image from Xie et al., 2020
pronephric duct cimap1b expression decreased distribution, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 6 with image from Xie et al., 2020
whole organism semi-viable, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 1 with image from Xie et al., 2020
testis dmc1 expression decreased amount, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 3 with image from Xie et al., 2020
spermatocyte reciprocal meiotic recombination arrested, abnormal e2f5ouc2019/ouc2019 standard conditions Fig 2 with image from Xie et al., 2020
testis apoptotic process increased occurrence, abnormal e2f5ouc2020/ouc2020 standard conditions Fig 2 with image from Xie et al., 2020
spermatocyte meiotic prophase I arrested, abnormal e2f5ouc2020/ouc2020 standard conditions Fig 2 with image from Xie et al., 2020
female sex determination disrupted, abnormal e2f5ouc2020/ouc2020 standard conditions Fig 1 with image,  Fig. S1 from Xie et al., 2020
spermatocyte decreased amount, abnormal e2f5ouc2020/ouc2020 standard conditions Fig 1 with image from Xie et al., 2020
meiosis I disrupted, abnormal e2f5ouc2020/ouc2020 standard conditions Fig 2 with image from Xie et al., 2020
testis translucent, abnormal e2f5ouc2020/ouc2020 standard conditions Fig. S1 from Xie et al., 2020
female organism absent, abnormal e2f5ouc2020/ouc2020 standard conditions Fig 1 with image,  Fig. S1 from Xie et al., 2020
spermatid decreased amount, abnormal e2f5ouc2020/ouc2020 standard conditions Fig 1 with image from Xie et al., 2020
male organism decreased male fertility, abnormal e2f5ouc2020/ouc2020 standard conditions Fig 1 with image from Xie et al., 2020
whole organism semi-viable, abnormal e2f5ouc2020/ouc2020 standard conditions Fig 1 with image from Xie et al., 2020
testis dmc1 expression decreased amount, abnormal e2f5ouc2020/ouc2020 standard conditions Fig 3 with image from Xie et al., 2020
spermatocyte reciprocal meiotic recombination arrested, abnormal e2f5ouc2020/ouc2020 standard conditions Fig 2 with image from Xie et al., 2020
testis apoptotic process increased occurrence, abnormal e2f5ouc2021/ouc2021 standard conditions Fig 2 with image from Xie et al., 2020
spermatocyte meiotic prophase I arrested, abnormal e2f5ouc2021/ouc2021 standard conditions Fig 2 with image from Xie et al., 2020
female sex determination disrupted, abnormal e2f5ouc2021/ouc2021 standard conditions Fig 1 with image,  Fig. S1 from Xie et al., 2020
spermatocyte decreased amount, abnormal e2f5ouc2021/ouc2021 standard conditions Fig 1 with image from Xie et al., 2020
meiosis I disrupted, abnormal e2f5ouc2021/ouc2021 standard conditions Fig 2 with image from Xie et al., 2020
testis translucent, abnormal e2f5ouc2021/ouc2021 standard conditions Fig. S1 from Xie et al., 2020
female organism absent, abnormal e2f5ouc2021/ouc2021 standard conditions Fig 1 with image,  Fig. S1 from Xie et al., 2020
spermatid decreased amount, abnormal e2f5ouc2021/ouc2021 standard conditions Fig 1 with image from Xie et al., 2020
male organism decreased male fertility, abnormal e2f5ouc2021/ouc2021 standard conditions Fig 1 with image from Xie et al., 2020
whole organism semi-viable, abnormal e2f5ouc2021/ouc2021 standard conditions Fig 1 with image from Xie et al., 2020
testis dmc1 expression decreased amount, abnormal e2f5ouc2021/ouc2021 standard conditions Fig 3 with image from Xie et al., 2020
spermatocyte reciprocal meiotic recombination arrested, abnormal e2f5ouc2021/ouc2021 standard conditions Fig 2 with image from Xie et al., 2020
pronephric proximal straight tubule multi-ciliated epithelial cell absent, exacerbated e2f4ouc2022/ouc2022; e2f5ouc2019/ouc2019 standard conditions Fig 4 with image from Xie et al., 2020
pronephric tubule multi-ciliated epithelial cell absent, abnormal e2f4ouc2022/ouc2022; e2f5ouc2019/ouc2019 standard conditions Fig 4 with image from Xie et al., 2020
pronephric tubule single ciliated epithelial cell increased amount, exacerbated e2f4ouc2022/ouc2022; e2f5ouc2019/ouc2019 standard conditions Fig 4 with image from Xie et al., 2020
olfactory pit multi-ciliated epithelial cell absent, abnormal e2f4ouc2022/ouc2022; e2f5ouc2019/ouc2019 standard conditions Fig. S5 from Xie et al., 2020
pronephric proximal convoluted tubule multi-ciliated epithelial cell absent, abnormal e2f4ouc2022/ouc2022; e2f5ouc2019/ouc2019 standard conditions Fig 4 with image from Xie et al., 2020
maintenance of ciliary planar beating movement pattern disrupted, abnormal e2f4ouc2022/ouc2022; e2f5ouc2019/ouc2019 standard conditions Fig 4 with image from Xie et al., 2020
pronephric tubule increased diameter, abnormal e2f4ouc2022/ouc2022; e2f5ouc2019/ouc2019 standard conditions Fig 4 with image from Xie et al., 2020
male organism decreased male fertility, ameliorated e2f5ouc2019/ouc2019; ouc2017Tg standard conditions Fig 3 with image from Xie et al., 2020
spermatocyte decreased amount, ameliorated e2f5ouc2019/ouc2019; ouc2017Tg standard conditions Fig 3 with image from Xie et al., 2020
spermatid decreased amount, ameliorated e2f5ouc2019/ouc2019; ouc2017Tg standard conditions Fig 3 with image from Xie et al., 2020
female sex determination disrupted, ameliorated e2f5ouc2019/ouc2019; ouc2018Tg standard conditions Fig. S1 from Xie et al., 2020
male organism decreased male fertility, ameliorated e2f5ouc2019/ouc2019; ouc2018Tg standard conditions Fig 1 with image from Xie et al., 2020
female organism decreased amount, ameliorated e2f5ouc2019/ouc2019; ouc2018Tg standard conditions Fig. S1 from Xie et al., 2020
male organism decreased male fertility, ameliorated e2f5ouc2020/ouc2020; ouc2017Tg standard conditions Fig 3 with image from Xie et al., 2020
spermatocyte decreased amount, ameliorated e2f5ouc2020/ouc2020; ouc2017Tg standard conditions Fig 3 with image from Xie et al., 2020
spermatid decreased amount, ameliorated e2f5ouc2020/ouc2020; ouc2017Tg standard conditions Fig 3 with image from Xie et al., 2020
male organism decreased male fertility, ameliorated e2f5ouc2020/ouc2020; ouc2018Tg standard conditions Fig 1 with image from Xie et al., 2020
female sex determination disrupted, ameliorated e2f5ouc2020/ouc2020; ouc2018Tg standard conditions Fig. S1 from Xie et al., 2020
female organism decreased amount, ameliorated e2f5ouc2020/ouc2020; ouc2018Tg standard conditions Fig. S1 from Xie et al., 2020
spermatid decreased amount, ameliorated e2f5ouc2021/ouc2021; ouc2017Tg standard conditions Fig 3 with image from Xie et al., 2020
spermatocyte decreased amount, ameliorated e2f5ouc2021/ouc2021; ouc2017Tg standard conditions Fig 3 with image from Xie et al., 2020
male organism decreased male fertility, ameliorated e2f5ouc2021/ouc2021; ouc2017Tg standard conditions Fig 3 with image from Xie et al., 2020
male organism decreased male fertility, ameliorated e2f5ouc2021/ouc2021; ouc2018Tg standard conditions Fig 1 with image from Xie et al., 2020
female sex determination disrupted, ameliorated e2f5ouc2021/ouc2021; ouc2018Tg standard conditions Fig. S1 from Xie et al., 2020
female organism decreased amount, ameliorated e2f5ouc2021/ouc2021; ouc2018Tg standard conditions Fig. S1 from Xie et al., 2020
whole organism morphology, abnormal tp53zdf1/+; e2f5ouc2019/+ standard conditions Fig. S1 from Xie et al., 2020
female organism present, ameliorated tp53zdf1/zdf1; e2f5ouc2019/ouc2019 standard conditions Fig 2 with image from Xie et al., 2020
female organism decreased female fertility, abnormal tp53zdf1/zdf1; e2f5ouc2019/ouc2019 standard conditions Fig 2 with image from Xie et al., 2020
female organism present, ameliorated tp53zdf1/zdf1; e2f5ouc2020/ouc2020 standard conditions Fig 2 with image from Xie et al., 2020
female organism decreased female fertility, abnormal tp53zdf1/zdf1; e2f5ouc2020/ouc2020 standard conditions Fig 2 with image from Xie et al., 2020
female organism decreased female fertility, abnormal tp53zdf1/zdf1; e2f5ouc2021/ouc2021 standard conditions Fig 2 with image from Xie et al., 2020
female organism present, ameliorated tp53zdf1/zdf1; e2f5ouc2021/ouc2021 standard conditions Fig 2 with image from Xie et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.