CRISPR

CRISPR3-thrab

ID
ZDB-CRISPR-200825-6
Name
CRISPR3-thrab
Previous Names
None
Target
Sequence
5' - GGGGGGGAAAGAGTTCAGTG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were added to improve binding.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nci103 thrab
nci104 thrab
Expression
Gene expression in Wild Types + CRISPR3-thrab
No data available
Phenotype
Phenotype resulting from CRISPR3-thrab
No data available
Phenotype of all Fish created by or utilizing CRISPR3-thrab
Phenotype Fish Conditions Figures
trunk integument cyt1l expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 6 from Han et al., 2020
whole organism thyroid hormone increased amount, abnormal thrabnci104/nci104 standard conditions Fig. 7 from Han et al., 2020
muscle igf3 expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 2 from Han et al., 2020
trunk integument col1a1b expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 5,  Fig. 6 from Han et al., 2020
trunk integument stat3 expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 5 from Han et al., 2020
whole organism decreased weight, abnormal thrabnci104/nci104 standard conditions Fig. 1,  Fig. 3 from Han et al., 2020
whole organism decreased width and length, abnormal thrabnci104/nci104 standard conditions Fig. 1,  Fig. 3 from Han et al., 2020
whole organism gh1 expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 8 from Han et al., 2020
trunk integument krt17 expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 5 from Han et al., 2020
whole organism pomca expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 8 from Han et al., 2020
whole organism trhrb expression increased amount, abnormal thrabnci104/nci104 standard conditions Fig. 8 from Han et al., 2020
trunk integument cyt1l expression absent, abnormal thrabnci104/nci104 standard conditions Fig. 5 from Han et al., 2020
whole organism tshba expression increased amount, abnormal thrabnci104/nci104 standard conditions Fig. 8 from Han et al., 2020
integument hypoplastic, abnormal thrabnci104/nci104 standard conditions Fig. 4 from Han et al., 2020
hypophysis gh1 expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 2,  Fig. 3 from Han et al., 2020
trunk integument cki expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 5,  Fig. 6 from Han et al., 2020
whole organism lhb expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 8 from Han et al., 2020
hypophysis smtla expression absent, abnormal thrabnci104/nci104 standard conditions Fig. 2 from Han et al., 2020
trunk muscle aplastic/hypoplastic, abnormal thrabnci104/nci104 standard conditions Fig. 4 from Han et al., 2020
trunk integument krt15 expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 5,  Fig. 6 from Han et al., 2020
trunk integument krt4 expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 5,  Fig. 6 from Han et al., 2020
trunk integument krt5 expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 5,  Fig. 6 from Han et al., 2020
hypophysis smtlb expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 2,  Fig. 3 from Han et al., 2020
hypophysis smtla expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 3 from Han et al., 2020
trunk integument krt18a.1 expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 5,  Fig. 6 from Han et al., 2020
whole organism smtlb expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 8 from Han et al., 2020
muscle igf1 expression decreased amount, abnormal thrabnci104/nci104 standard conditions Fig. 2 from Han et al., 2020
cardiac ventricle sarcomere structurally discontinuous, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart heart contraction decreased rate, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 3 from Han et al., 2020
cardiac ventricle sarcomere decreased width, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart Ab3-atp2a2 labeling decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
heart mybpc3 expression increased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart slc8a1a expression decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
heart ab9-mapk labeling decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
pericardium dilated, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 5 from Han et al., 2020
heart ryr2b expression decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
heart nexn expression increased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart tnnt2a expression decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
cardiac ventricle sarcomere increased length, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart actn2b expression increased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart myh6 expression decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart pln1 expression decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
heart atp2a2a expression decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
heart hbae1.1 expression increased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
atrium dilated, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 1,  Fig. 5 from Han et al., 2020
cardiac ventricle circular, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 1,  Fig. 5 from Han et al., 2020
heart myh7 expression decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart ldb3a expression decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart smyd1b expression increased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart mypn expression decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart Ab3-tnnt2 labeling decreased amount, abnormal thrabnci104/nci104 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
Citations