CRISPR

CRISPR3-thraa

ID
ZDB-CRISPR-200825-5
Name
CRISPR3-thraa
Previous Names
None
Target
Sequence
5' - GGTCCCGCCGCTCTTCCTGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The first two "G"s were likely added to improve binding.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
nci101 thraa
nci102 thraa
Expression
Gene expression in Wild Types + CRISPR3-thraa
No data available
Phenotype
Phenotype resulting from CRISPR3-thraa
No data available
Phenotype of all Fish created by or utilizing CRISPR3-thraa
Phenotype Fish Conditions Figures
cardiac ventricle sarcomere decreased length, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
atrium dilated, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 1Fig. 5 from Han et al., 2020
heart hbae1.1 expression increased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
cardiac ventricle sarcomere structurally discontinuous, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart mybpc3 expression increased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart heart contraction decreased rate, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 3 from Han et al., 2020
heart myh7 expression decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart ldb3a expression decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart slc8a1a expression decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
heart mypn expression decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart tnnt2a expression decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
blood decreased fluid flow, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 3Fig. 5 from Han et al., 2020
heart smyd1b expression decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart actn2b expression increased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart nexn expression increased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart atp2a2a expression decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
heart myh6 expression decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
heart ab9-mapk labeling decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
heart Ab3-tnnt2 labeling decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
heart tcap expression decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 4 from Han et al., 2020
atrium displaced, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 1Fig. 5 from Han et al., 2020
heart pln expression decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
heart Ab3-atp2a2 labeling decreased amount, abnormal thraanci102/nci102 (NHGRI-1) standard conditions Fig. 2 from Han et al., 2020
Citations