CRISPR

CRISPR2-nr1i2

ID
ZDB-CRISPR-200429-6
Name
CRISPR2-nr1i2
Previous Names
None
Target
Sequence
5' - GGGACACGGTGATGGGTCTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was AGG at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
sib3 nr1i2
sib4 nr1i2
wh1 nr1i2
Expression
Gene expression in Wild Types + CRISPR2-nr1i2
No data available
Phenotype
Phenotype resulting from CRISPR2-nr1i2
No data available
Phenotype of all Fish created by or utilizing CRISPR2-nr1i2
Phenotype Fish Conditions Figures
whole organism cadmium cation decreased amount, abnormal nr1i2sib3/sib3 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
glutathione transferase activity increased process quality, abnormal nr1i2sib3/sib3 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism nr1i2 expression amount, ameliorated nr1i2sib3/sib3 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism abcc2 expression increased amount, abnormal nr1i2sib3/sib3 (AB) standard conditions text only from Hu et al., 2019
whole organism nr1i2 expression increased amount, abnormal nr1i2sib3/sib3 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism silver cation increased amount, abnormal nr1i2sib3/sib3 (AB) chemical treatment by environment: silver(1+) nitrate, chemical treatment by environment: reversine text only from Hu et al., 2019
whole organism abcb4 expression amount, ameliorated nr1i2sib3/sib3 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism ahr2 expression increased amount, abnormal nr1i2sib3/sib3 (AB) standard conditions text only from Hu et al., 2019
whole organism nr1i2 expression amount, ameliorated nr1i2sib3/sib3 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism abcc2 expression amount, ameliorated nr1i2sib3/sib3 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism abcc1 expression amount, ameliorated nr1i2sib3/sib3 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism cadmium cation increased amount, abnormal nr1i2sib3/sib3 (AB) chemical treatment by environment: MK 571, chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
glutathione transferase activity increased process quality, abnormal nr1i2sib3/sib3 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism abcc1 expression increased amount, abnormal nr1i2sib3/sib3 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism cadmium cation increased amount, abnormal nr1i2sib3/sib3 (AB) chemical treatment by environment: cadmium dichloride, chemical treatment by environment: reversine text only from Hu et al., 2019
whole organism abcb4 expression increased amount, abnormal nr1i2sib3/sib3 (AB) standard conditions text only from Hu et al., 2019
whole organism silver cation increased amount, abnormal nr1i2sib3/sib3 (AB) chemical treatment by environment: MK 571, chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism abcc1 expression increased amount, abnormal nr1i2sib3/sib3 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism nr1i2 expression increased amount, abnormal nr1i2sib3/sib3 (AB) standard conditions text only from Hu et al., 2019
whole organism abcc2 expression amount, ameliorated nr1i2sib3/sib3 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism pparab expression increased amount, abnormal nr1i2sib3/sib3 (AB) standard conditions text only from Hu et al., 2019
whole organism nfe2l2a expression increased amount, abnormal nr1i2sib3/sib3 (AB) standard conditions text only from Hu et al., 2019
whole organism nr1i2 expression increased amount, abnormal nr1i2sib3/sib3 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism abcb4 expression amount, ameliorated nr1i2sib3/sib3 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism cadmium cation decreased amount, abnormal nr1i2sib4/sib4 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism nr1i2 expression amount, ameliorated nr1i2sib4/sib4 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
glutathione transferase activity increased process quality, abnormal nr1i2sib4/sib4 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism abcc2 expression increased amount, abnormal nr1i2sib4/sib4 (AB) standard conditions text only from Hu et al., 2019
whole organism nr1i2 expression increased amount, abnormal nr1i2sib4/sib4 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism silver cation increased amount, abnormal nr1i2sib4/sib4 (AB) chemical treatment by environment: silver(1+) nitrate, chemical treatment by environment: reversine text only from Hu et al., 2019
whole organism abcb4 expression amount, ameliorated nr1i2sib4/sib4 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism ahr2 expression increased amount, abnormal nr1i2sib4/sib4 (AB) standard conditions text only from Hu et al., 2019
whole organism abcc2 expression amount, ameliorated nr1i2sib4/sib4 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism nr1i2 expression amount, ameliorated nr1i2sib4/sib4 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism abcc1 expression amount, ameliorated nr1i2sib4/sib4 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
glutathione transferase activity increased process quality, abnormal nr1i2sib4/sib4 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism cadmium cation increased amount, abnormal nr1i2sib4/sib4 (AB) chemical treatment by environment: MK 571, chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism abcc1 expression increased amount, abnormal nr1i2sib4/sib4 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism cadmium cation increased amount, abnormal nr1i2sib4/sib4 (AB) chemical treatment by environment: cadmium dichloride, chemical treatment by environment: reversine text only from Hu et al., 2019
whole organism abcb4 expression increased amount, abnormal nr1i2sib4/sib4 (AB) standard conditions text only from Hu et al., 2019
whole organism silver cation increased amount, abnormal nr1i2sib4/sib4 (AB) chemical treatment by environment: MK 571, chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism abcc1 expression increased amount, abnormal nr1i2sib4/sib4 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism nr1i2 expression increased amount, abnormal nr1i2sib4/sib4 (AB) standard conditions text only from Hu et al., 2019
whole organism abcc2 expression amount, ameliorated nr1i2sib4/sib4 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism nfe2l2a expression increased amount, abnormal nr1i2sib4/sib4 (AB) standard conditions text only from Hu et al., 2019
whole organism pparab expression increased amount, abnormal nr1i2sib4/sib4 (AB) standard conditions text only from Hu et al., 2019
whole organism nr1i2 expression increased amount, abnormal nr1i2sib4/sib4 (AB) chemical treatment by environment: cadmium dichloride text only from Hu et al., 2019
whole organism abcb4 expression amount, ameliorated nr1i2sib4/sib4 (AB) chemical treatment by environment: silver(1+) nitrate text only from Hu et al., 2019
whole organism nr1i2 expression increased amount, abnormal nr1i2wh1/wh1 (AB) chemical treatment by environment: pregnenolone Fig. 4 from Salanga et al., 2019
whole organism nr1i2 expression increased amount, abnormal nr1i2wh1/wh1 (AB) chemical treatment by environment: pregnenolone Fig. 5 from Salanga et al., 2019
whole organism cyp3a65 expression increased amount, abnormal nr1i2wh1/wh1 (AB) chemical treatment by environment: pregnenolone Fig. 4 from Salanga et al., 2019
whole organism cyp3a65 expression increased amount, abnormal nr1i2wh1/wh1 (AB) chemical treatment by environment: pregnenolone Fig. 5 from Salanga et al., 2019
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.