CRISPR

CRISPR1-park7

ID
ZDB-CRISPR-200429-13
Name
CRISPR1-park7
Previous Names
None
Target
Sequence
5' - GGTGGATGTGATGCGCAGAG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was CGG at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
ub2000 park7
Expression
Gene expression in Wild Types + CRISPR1-park7
No data available
Phenotype
Phenotype resulting from CRISPR1-park7
No data available
Phenotype of all Fish created by or utilizing CRISPR1-park7
Phenotype Fish Conditions Figures
brain Ab3-park7 labeling absent, abnormal park7ub2000/ub2000 standard conditions Figure 1 with image from Gharbi et al., 2021
retinal pigmented epithelium composition, abnormal park7ub2000/ub2000 standard conditions Figure 3 with imageFigure 4 with image from Gharbi et al., 2021
whole organism decreased weight, abnormal park7ub2000/ub2000 standard conditions Fig. 2 from Edson et al., 2019
whole organism park7 expression absent, abnormal park7ub2000/ub2000 standard conditions Fig. 1 from Edson et al., 2019
brain park7 expression absent, abnormal park7ub2000/ub2000 standard conditions Fig. 4 from Edson et al., 2019
retinal ganglion cell decreased amount, abnormal park7ub2000/ub2000 standard conditions Figure 2 with image from Gharbi et al., 2021
retinal pigmented epithelium phagocytic vesicle increased amount, abnormal park7ub2000/ub2000 standard conditions Figure 4 with image from Gharbi et al., 2021
brain AB1-abce1 labeling increased amount, abnormal park7ub2000/ub2000 standard conditions Fig. 4 from Edson et al., 2019
brain AB1-gsta labeling increased amount, abnormal park7ub2000/ub2000 standard conditions Fig. 4 from Edson et al., 2019
retinal photoreceptor layer organization quality, abnormal park7ub2000/ub2000 standard conditions Figure 2 with image from Gharbi et al., 2021
NADH dehydrogenase (ubiquinone) activity decreased efficacy, abnormal park7ub2000/ub2000 standard conditions Fig. 2 from Edson et al., 2019
retina decreased thickness, abnormal park7ub2000/ub2000 standard conditions Figure 2 with image from Gharbi et al., 2021
Muller cell Ab19-gfp labeling absent, abnormal park7ub2000/ub2000 standard conditions Figure 1 with image from Gharbi et al., 2021
retinal pigmented epithelium vacuole increased amount, abnormal park7ub2000/ub2000 standard conditions Figure 2 with imageFigure 3 with imageFigure 4 with image from Gharbi et al., 2021
brain ab1-th labeling decreased amount, abnormal park7ub2000/ub2000 standard conditions Fig. 2 from Edson et al., 2019
brain Ab3-park7 labeling amount, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 1 with image from Gharbi et al., 2021
retinal pigmented epithelium vacuole amount, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 2 with imageFigure 3 with image from Gharbi et al., 2021
retinal photoreceptor layer organization quality, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 2 with image from Gharbi et al., 2021
retinal pigmented epithelium composition, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 3 with image from Gharbi et al., 2021
retinal ganglion cell amount, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 2 with image from Gharbi et al., 2021
retina thickness, ameliorated park7ub2000/ub2000; ub1001Tg standard conditions Figure 2 with image from Gharbi et al., 2021
brain Ab3-park7 labeling amount, ameliorated park7ub2000/ub2000; ub2003Tg standard conditions Figure 1 with image from Gharbi et al., 2021
retinal photoreceptor layer organization quality, ameliorated park7ub2000/ub2000; ub2003Tg standard conditions Figure 2 with image from Gharbi et al., 2021
retinal pigmented epithelium composition, ameliorated park7ub2000/ub2000; ub2003Tg standard conditions Figure 3 with image from Gharbi et al., 2021
retinal ganglion cell decreased amount, abnormal park7ub2000/ub2000; ub2003Tg standard conditions Figure 2 with image from Gharbi et al., 2021
retinal pigmented epithelium vacuole increased amount, abnormal park7ub2000/ub2000; ub2003Tg standard conditions Figure 2 with imageFigure 3 with image from Gharbi et al., 2021
retina thickness, ameliorated park7ub2000/ub2000; ub2003Tg standard conditions Figure 2 with image from Gharbi et al., 2021
Citations