CRISPR

CRISPR2-thrab

ID

ZDB-CRISPR-200129-1

Name

CRISPR2-thrab

Previous Names

None

Target

thrab (1)

Sequence

5' - AAGCTACCGGATATCACTAC - 3'

Disclaimer

Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.

Note

None

Genome Resources

None

Target Location

Constructs

No data available

Genomic Features

Genomic Feature	Affected Genomic Regions
vp31rc1	thrab

Expression

Gene expression in Wild Types + CRISPR2-thrab

No data available

Phenotype

Phenotype resulting from CRISPR2-thrab

No data available

Phenotype of all Fish created by or utilizing CRISPR2-thrab

Phenotype	Fish	Conditions	Figures
eye all-trans-3,4-didehydroretinol increased amount, abnormal	thrab^{vp31rc1/vp31rc1}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal	thrab^{vp31rc1/vp31rc1}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
scale EGFP expression spatial pattern, abnormal	thrab^{vp31rc1/vp31rc1}; b1212Tg	standard conditions	Fig. 5 from Aman et al., 2021
scale primordium EGFP expression spatial pattern, abnormal	thrab^{vp31rc1/vp31rc1}; b1212Tg	standard conditions	Fig. 5 from Aman et al., 2021
eye all-trans-3,4-didehydroretinol increased amount, abnormal	thraa^{vp33rc1/vp33rc1}; thrab^{vp31rc1/vp31rc1}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal	thraa^{vp33rc1/vp33rc1}; thrab^{vp31rc1/vp31rc1}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
scale increased amount, abnormal	thrab^vp31rc1/+; b1212Tg; wprt8Tg/wprt8Tg	standard conditions	Fig. 5 from Aman et al., 2021
scale negative regulation of dermatome development onset quality, abnormal	thrab^vp31rc1/+; b1212Tg; wprt8Tg/wprt8Tg	standard conditions	Fig. 5 from Aman et al., 2021
scale irregular spatial pattern, abnormal	thrab^vp31rc1/+; b1212Tg; wprt8Tg/wprt8Tg	standard conditions	Fig. 5 from Aman et al., 2021
scale decreased size, abnormal	thrab^vp31rc1/+; b1212Tg; wprt8Tg/wprt8Tg	standard conditions	Fig. 5 from Aman et al., 2021
eye all-trans-3,4-didehydroretinol increased amount, abnormal	thrab^{vp31rc1/vp31rc1}; thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal	thrab^{vp31rc1/vp31rc1}; thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
xanthophore decreased amount, ameliorated	thrab^{vp31rc1/vp31rc1}; wprt8Tg (AB)	chemical treatment by environment: metronidazole	Figure 7 from Saunders et al., 2019
integument carotenoid decreased amount, abnormal	thrab^{vp31rc1/vp31rc1}; wprt8Tg (AB)	chemical treatment by environment: metronidazole	Figure 7—figure supplement 1. from Saunders et al., 2019
melanocyte amount, ameliorated	thrab^{vp31rc1/vp31rc1}; wprt8Tg (AB)	chemical treatment by environment: metronidazole	Figure 7 from Saunders et al., 2019
eye cyp27c1 expression amount, ameliorated	thraa^{vp33rc1/vp33rc1}; thrab^{vp31rc1/vp31rc1}; thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol normal amount, ameliorated	thraa^{vp33rc1/vp33rc1}; thrab^{vp31rc1/vp31rc1}; thrb^{stl627/stl627}	chemical treatment by environment: thyroid hormone	Fig. 2 from Volkov et al., 2020
xanthophore decreased amount, ameliorated	thraa^{vp33rc1/vp33rc1}; thrab^{vp31rc1/vp31rc1}; wprt8Tg (AB)	chemical treatment by environment: metronidazole	Figure 7 from Saunders et al., 2019
melanocyte amount, ameliorated	thraa^{vp33rc1/vp33rc1}; thrab^{vp31rc1/vp31rc1}; wprt8Tg (AB)	chemical treatment by environment: metronidazole	Figure 7 from Saunders et al., 2019
xanthophore amount, ameliorated	thraa^{vp33rc1/vp33rc1}; thrab^{vp31rc1/vp31rc1}; thrb^{vp34rc1/vp34rc1}; wprt8Tg (AB)	chemical treatment by environment: metronidazole	Figure 7 from Saunders et al., 2019
melanocyte amount, ameliorated	thraa^{vp33rc1/vp33rc1}; thrab^{vp31rc1/vp31rc1}; thrb^{vp34rc1/vp34rc1}; wprt8Tg (AB)	chemical treatment by environment: metronidazole	Figure 7 from Saunders et al., 2019

Citations