CRISPR

CRISPR3-nfe2l2a

ID
ZDB-CRISPR-190816-1
Name
CRISPR3-nfe2l2a
Previous Names
None
Target
Sequence
5' - GGATCTGGGCGCGGGCCGTG - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
The PAM site was "AGG" at the 3' end.
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
dw213 nfe2l2a
dw214a nfe2l2a
w210 nfe2l2a
w211 nfe2l2a
w212 nfe2l2a
zf3103 nfe2l2a
Expression
Gene expression in Wild Types + CRISPR3-nfe2l2a
No data available
Phenotype
Phenotype resulting from CRISPR3-nfe2l2a
No data available
Phenotype of all Fish created by or utilizing CRISPR3-nfe2l2a
Phenotype Fish Conditions Figures
whole organism gclc expression decreased amount, abnormal nfe2l2adw213/dw213 (EKW) chemical treatment by environment: (-)-carvone Fig. 2 from Mills et al., 2019
whole organism gpx1a expression decreased amount, abnormal nfe2l2adw213/dw213 (EKW) chemical treatment by environment: (-)-carvone Fig. 2 from Mills et al., 2019
whole organism sod1 expression decreased amount, abnormal nfe2l2adw213/dw213 (EKW) chemical treatment by environment: (-)-carvone Fig. 2 from Mills et al., 2019
whole organism gstp1.2 expression increased amount, abnormal nfe2l2adw213/dw213 (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 1 from Mills et al., 2019
whole organism gpx1a expression increased amount, abnormal nfe2l2adw213/dw213 (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 2 from Mills et al., 2019
whole organism gpx1a expression increased amount, abnormal nfe2l2adw213/dw213 (EKW) control Fig. 2 from Mills et al., 2019
whole organism sod2 expression decreased amount, abnormal nfe2l2adw213/dw213 (EKW) chemical treatment by environment: (-)-carvone Fig. 2 from Mills et al., 2019
whole organism gclc expression increased amount, abnormal nfe2l2adw213/dw213 (EKW) control Fig. 2 from Mills et al., 2019
whole organism hmox1a expression increased amount, abnormal nfe2l2adw213/dw213 (EKW) chemical treatment by environment: (-)-carvone Fig. 2 from Mills et al., 2019
whole organism nqo1 expression increased amount, abnormal nfe2l2adw213/dw213 (EKW) chemical treatment by environment: cumene hydroperoxide Fig. 2 from Mills et al., 2019
whole organism gstp1.2 expression increased amount, abnormal nfe2l2adw213/dw213 (EKW) chemical treatment by environment: cumene hydroperoxide Fig. 2 from Mills et al., 2019
whole organism decreased life span, abnormal nfe2l2adw213/dw213 (EKW) standard conditions text only from Mills et al., 2019
whole organism gstp1.2 expression increased amount, abnormal nfe2l2adw213/dw213 (EKW) control Fig. 1,  Fig. 2 from Mills et al., 2019
whole organism viability, abnormal nfe2l2adw213/dw213 (EKW) standard conditions Table 1 from Mills et al., 2019
whole organism prdx1 expression increased amount, abnormal nfe2l2adw213/dw213 (EKW) control Fig. 2 from Mills et al., 2019
whole organism gstp1.2 expression increased amount, abnormal nfe2l2adw214a/dw214a (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 1 from Mills et al., 2019
whole organism decreased life span, abnormal nfe2l2adw214a/dw214a (EKW) standard conditions text only from Mills et al., 2019
whole organism gstp1.2 expression increased amount, abnormal nfe2l2adw214a/dw214a (EKW) control Fig. 1 from Mills et al., 2019
whole organism dead, abnormal nfe2l2adw214a/dw214a (EKW) standard conditions text only from Mills et al., 2019
whole organism gstp1.2 expression decreased amount, abnormal nfe2l2aw210/w210 (EKW) control Fig. 1 from Mills et al., 2019
whole organism gstp1.2 expression decreased amount, abnormal nfe2l2aw210/w210 (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 1 from Mills et al., 2019
response to toxic substance process quality, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: cumene hydroperoxide Fig. 3 from Mills et al., 2019
whole organism gclc expression decreased amount, abnormal nfe2l2aw211/w211 (EKW) control Fig. 2 from Mills et al., 2019
whole organism nqo1 expression decreased amount, abnormal nfe2l2aw211/w211 (EKW) control Fig. 2 from Mills et al., 2019
response to hydroperoxide process quality, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 3 from Mills et al., 2019
whole organism gpx1a expression decreased amount, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: (-)-carvone Fig. 2 from Mills et al., 2019
whole organism dead, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 3 from Mills et al., 2019
whole organism sod1 expression decreased amount, abnormal nfe2l2aw211/w211 (EKW) control Fig. 2 from Mills et al., 2019
whole organism sod1 expression decreased amount, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: (-)-carvone Fig. 2 from Mills et al., 2019
whole organism gstp1.2 expression decreased amount, abnormal nfe2l2aw211/w211 (EKW) control Fig. 1,  Fig. 2 from Mills et al., 2019
whole organism sod2 expression decreased amount, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: (-)-carvone Fig. 2 from Mills et al., 2019
whole organism hmox1a expression increased amount, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: (-)-carvone Fig. 2 from Mills et al., 2019
whole organism dead, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: cumene hydroperoxide Fig. 3 from Mills et al., 2019
whole organism nqo1 expression decreased amount, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: (-)-carvone Fig. 2 from Mills et al., 2019
whole organism hmox1a expression increased amount, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: cumene hydroperoxide Fig. 2 from Mills et al., 2019
whole organism hmox1a expression increased amount, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 2 from Mills et al., 2019
whole organism gstp1.2 expression decreased amount, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 1 from Mills et al., 2019
whole organism prdx1 expression decreased amount, abnormal nfe2l2aw211/w211 (EKW) control Fig. 2 from Mills et al., 2019
whole organism sod1 expression decreased amount, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 2 from Mills et al., 2019
response to hydroperoxide process quality, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: cumene hydroperoxide Fig. 3 from Mills et al., 2019
response to toxic substance process quality, abnormal nfe2l2aw211/w211 (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 3 from Mills et al., 2019
whole organism gstp1.2 expression decreased amount, abnormal nfe2l2aw212/w212 (EKW) control Fig. 1 from Mills et al., 2019
whole organism gstp1.2 expression decreased amount, abnormal nfe2l2aw212/w212 (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 1 from Mills et al., 2019
whole organism life span, ameliorated nfe2l2adw213/+ (EKW) chemical treatment by environment: tert-butyl hydroperoxide Fig. 3 from Mills et al., 2019
whole organism decreased length, abnormal nfe2l2adw214a/+ (EKW) standard conditions Table 1 from Mills et al., 2019
hepatocyte necrotic, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: paracetamol Fig. 6 from Yamashita et al., 2018
whole organism gstp1.2 expression decreased amount, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: paracetamol Fig. 7 from Yamashita et al., 2018
hepatocyte vacuolated, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: paracetamol Fig. 6 from Yamashita et al., 2018
whole organism nfe2l2b expression increased amount, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: paracetamol Fig. 7 from Yamashita et al., 2018
whole organism dead, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: hydrogen peroxide Fig. 3 from Yamashita et al., 2018
whole organism nfe2l2b expression increased amount, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: hydrogen peroxide Fig. 4 from Yamashita et al., 2018
whole organism keap1b expression decreased amount, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: paracetamol Fig. 7 from Yamashita et al., 2018
whole organism gclc expression decreased amount, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 control Fig. 4 from Yamashita et al., 2018
heart contraction process quality, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: doxorubicin Fig. 8 from Yamashita et al., 2018
whole organism dead, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: sulforaphane, chemical treatment by environment: hydrogen peroxide Fig. 3 from Yamashita et al., 2018
liver decreased size, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: paracetamol Fig. 5 from Yamashita et al., 2018
heart contraction decreased rate, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: doxorubicin Fig. 8 from Yamashita et al., 2018
whole organism gstp1.2 expression decreased amount, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 control Fig. 7 from Yamashita et al., 2018
whole organism gclc expression decreased amount, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: hydrogen peroxide Fig. 4 from Yamashita et al., 2018
whole organism decreased life span, abnormal mitfab692/b692; nfe2l2azf3103/zf3103 chemical treatment by environment: hydrogen peroxide Fig. 2 from Yamashita et al., 2018
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.