CRISPR

CRISPR2-thrb

ID
ZDB-CRISPR-190809-4
Name
CRISPR2-thrb
Previous Names
None
Target
Sequence
5' - GGGAGAACCGTGAACGCCGA - 3'
ZFIN BLAST NCBI BLAST Ensembl UCSC BLAT
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
stl627 thrb
stl628 thrb
Expression
Gene expression in Wild Types + CRISPR2-thrb
Expressed Gene Anatomy Figures
dio2 Fig. 5 from Lazcano et al., 2019
dio3a Fig. 5 from Lazcano et al., 2019
ets1 Fig. 6 from Lazcano et al., 2019
eve1 Fig. 6 from Lazcano et al., 2019
fgf1b Fig. 6 from Lazcano et al., 2019
foxd3 Fig. 6 from Lazcano et al., 2019
mbpa Fig. 7 from Lazcano et al., 2019
mpz Fig. 7 from Lazcano et al., 2019
msx1a Fig. 6 from Lazcano et al., 2019
olig2 Fig. 7 from Lazcano et al., 2019
pax7a Fig. 6 from Lazcano et al., 2019
plp1b Fig. 7 from Lazcano et al., 2019
slc16a2 Fig. 5 from Lazcano et al., 2019
sox10 Fig. 6 from Lazcano et al., 2019
thraa Fig. 5 from Lazcano et al., 2019
thrab Fig. 5 from Lazcano et al., 2019
thrb Fig. 5 from Lazcano et al., 2019
zic1 Fig. 6 from Lazcano et al., 2019
Phenotype
Phenotype resulting from CRISPR2-thrb
Phenotype Fish Figures
caudal fin deformed, abnormal WT + CRISPR2-thrb Fig. 4 with image from Lazcano et al., 2019
whole organism dio2 expression decreased amount, abnormal WT + CRISPR2-thrb Fig. 5 from Lazcano et al., 2019
whole organism decreased size, abnormal WT + CRISPR2-thrb Fig. 4 with image from Lazcano et al., 2019
whole organism eve1 expression increased amount, abnormal WT + CRISPR2-thrb Fig. 6 from Lazcano et al., 2019
whole organism dio3a expression increased amount, abnormal WT + CRISPR2-thrb Fig. 5 from Lazcano et al., 2019
whole organism pax7a expression increased amount, abnormal WT + CRISPR2-thrb Fig. 6 from Lazcano et al., 2019
whole organism zic1 expression increased amount, abnormal WT + CRISPR2-thrb Fig. 6 from Lazcano et al., 2019
Phenotype of all Fish created by or utilizing CRISPR2-thrb
Phenotype Fish Conditions Figures
retina si:busm1-57f23.1 expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
retinal cone cell ab3-rho labeling amount, ameliorated thrbstl627/stl627 standard conditions Fig. 3 from Volkov et al., 2020
retina mhc1uba expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
retinal cone cell decreased amount, abnormal thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 3 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
retinal cone cell arr3b expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 3 from Volkov et al., 2020
retina opn1lw2 expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol increased amount, abnormal thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
retina detection of visible light decreased efficacy, abnormal thrbstl627/stl627 visible light Fig. 4 from Volkov et al., 2020
retinal cone cell arr3a expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 3 from Volkov et al., 2020
retina mir726 expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
retina serinc2 expression increased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
retina opn1lw1 expression decreased amount, abnormal thrbstl627/stl627 standard conditions Fig. 5 from Volkov et al., 2020
whole organism decreased size, abnormal WT + CRISPR2-thrb standard conditions Fig. 4 with image from Lazcano et al., 2019
whole organism zic1 expression increased amount, abnormal WT + CRISPR2-thrb standard conditions Fig. 6 from Lazcano et al., 2019
whole organism pax7a expression increased amount, abnormal WT + CRISPR2-thrb standard conditions Fig. 6 from Lazcano et al., 2019
whole organism dio2 expression decreased amount, abnormal WT + CRISPR2-thrb standard conditions Fig. 5 from Lazcano et al., 2019
whole organism dio3a expression increased amount, abnormal WT + CRISPR2-thrb standard conditions Fig. 5 from Lazcano et al., 2019
caudal fin deformed, abnormal WT + CRISPR2-thrb standard conditions Fig. 4 with image from Lazcano et al., 2019
whole organism eve1 expression increased amount, abnormal WT + CRISPR2-thrb standard conditions Fig. 6 from Lazcano et al., 2019
retinal cone cell retinal cone cell differentiation disrupted, abnormal thrbstl627/stl627; q22Tg standard conditions Fig. 6 from Volkov et al., 2020
retinal outer nuclear layer retinal cone cell ab3-rho labeling absent, abnormal thrbstl627/stl627; q22Tg standard conditions Fig. 6 from Volkov et al., 2020
retinal inner nuclear layer arr3a expression mislocalised, abnormal thrbstl627/stl627; q22Tg standard conditions Fig. 6 from Volkov et al., 2020
retinal outer nuclear layer retinal cone cell cell morphology, abnormal thrbstl627/stl627; q22Tg standard conditions Fig. 6 from Volkov et al., 2020
retinal inner nuclear layer Tomato expression mislocalised, abnormal thrbstl627/stl627; q22Tg standard conditions Fig. 6 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol increased amount, ameliorated thraavp33rc1/vp33rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal thraavp33rc1/vp33rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression increased amount, abnormal thrabvp31rc1/vp31rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol increased amount, abnormal thrabvp31rc1/vp31rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
eye cyp27c1 expression amount, ameliorated thraavp33rc1/vp33rc1; thrabvp31rc1/vp31rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
eye all-trans-3,4-didehydroretinol normal amount, ameliorated thraavp33rc1/vp33rc1; thrabvp31rc1/vp31rc1; thrbstl627/stl627 chemical treatment by environment: thyroid hormone Fig. 2 from Volkov et al., 2020
Citations
Your Input Welcome
We welcome your input and comments. Please use this form to recommend updates to the information in ZFIN. We appreciate as much detail as possible and references as appropriate. We will review your comments promptly.
Please check the highlighted fields and try again.
Thank you for submitting comments. Your input has been emailed to ZFIN curators who may contact you if additional information is required.
Oops. Something went wrong. Please try again later.