CRISPR

CRISPR1-myog

ID
ZDB-CRISPR-190125-5
Name
CRISPR1-myog
Previous Names
None
Target
Sequence
5' - GGAGCTCCTGTCCTGATATC - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
kg125 myog
kg128 myog
Expression
Gene expression in Wild Types + CRISPR1-myog
No data available
Phenotype
Phenotype resulting from CRISPR1-myog
No data available
Phenotype of all Fish created by or utilizing CRISPR1-myog
Phenotype Fish Conditions Figures
whole organism myf6 expression decreased amount, abnormal myogkg125/kg125 (TL) standard conditions Fig. 2 with image from Ganassi et al., 2018
myotome skeletal muscle cell myog expression absent, abnormal myogkg125/kg125 (TL) standard conditions Fig. 1 with image from Ganassi et al., 2018
myotome skeletal muscle cell myog expression decreased amount, abnormal myogkg125/kg125 (TL) standard conditions Fig. 1 with image from Ganassi et al., 2018
whole organism myog expression decreased amount, abnormal myogkg125/kg125 (TL) standard conditions Fig. 1 with image from Ganassi et al., 2018
myotome fast muscle cell disorganized, abnormal myogkg125/kg125 (TL) standard conditions Fig. 2 with image from Ganassi et al., 2018
whole organism mymk expression decreased amount, abnormal myogkg125/kg125 (TL) standard conditions Fig. 5 with imageFig. 6 with image from Ganassi et al., 2018
myotome skeletal muscle tissue development decreased process quality, abnormal myogkg125/kg125 (TL) control Fig. 6 with image from Ganassi et al., 2018
whole organism mymx expression decreased amount, abnormal myogkg125/kg125 (TL) standard conditions Fig. 5 with image from Ganassi et al., 2018
somite skeletal muscle cell mymk expression decreased amount, abnormal myogkg125/kg125 (TL) chemical treatment by environment: Cyclopamine Fig. 6 with image from Ganassi et al., 2018
whole organism mymk expression decreased amount, abnormal myogkg125/kg125 (TL) chemical treatment by environment: Cyclopamine Fig. 6 with image from Ganassi et al., 2018
whole organism jam3b expression decreased amount, abnormal myogkg125/kg125 (TL) standard conditions Fig. 5 with image from Ganassi et al., 2018
myotome skeletal muscle tissue development decreased process quality, exacerbated myogkg125/kg125 (TL) chemical treatment by environment: Cyclopamine Fig. 6 with image from Ganassi et al., 2018
whole organism decreased weight, abnormal myogkg125/kg125 (TL) standard conditions Fig. 7 with image from Ganassi et al., 2018
somite skeletal muscle cell mymk expression decreased amount, abnormal myogkg125/kg125 (TL) standard conditions Fig. 6 with image from Ganassi et al., 2018
skeletal muscle cell nucleus myog expression absent, abnormal myogkg125/kg125 (TL) standard conditions Fig. 1 with image from Ganassi et al., 2018
whole organism myf5 expression decreased amount, abnormal myogkg125/kg125 (TL) standard conditions Fig. 2 with image from Ganassi et al., 2018
myotome decreased height, abnormal myogkg128/kg128 (TL) standard conditions Fig. 3 with image from Ganassi et al., 2018
myotome skeletal muscle cell myog expression decreased amount, abnormal myogkg128/kg128 (TL) standard conditions Fig. 1 with image from Ganassi et al., 2018
myotome fast muscle cell decreased area, abnormal myogkg128/kg128 (TL) standard conditions Fig. 7 with image from Ganassi et al., 2018
fast muscle cell has fewer parts of type fast muscle cell nucleus, abnormal myogkg128/kg128 (TL) standard conditions Fig. 7 with image from Ganassi et al., 2018
whole organism decreased weight, abnormal myogkg128/kg128 (TL) standard conditions Fig. 7 with image from Ganassi et al., 2018
somite skeletal muscle cell mymk expression decreased amount, abnormal myogkg128/kg128 (TL) standard conditions Fig. 5 with image from Ganassi et al., 2018
somite skeletal muscle cell jam3b expression decreased amount, abnormal myogkg128/kg128 (TL) standard conditions Fig. 5 with image from Ganassi et al., 2018
myotome has extra parts of type fast muscle cell, abnormal myogkg128/kg128 (TL) standard conditions Fig. 7 with image from Ganassi et al., 2018
fast muscle cell myoblast fusion decreased occurrence, abnormal myogkg125/kg125; vu119Tg control Fig. 6 with image from Ganassi et al., 2018
fast muscle cell myoblast fusion decreased occurrence, exacerbated myogkg125/kg125; vu119Tg chemical treatment by environment: Cyclopamine Fig. 6 with image from Ganassi et al., 2018
fast muscle cell has fewer parts of type fast muscle cell nucleus, abnormal myogkg128/kg128 ; vu119Tg standard conditions Fig. 4 with image from Ganassi et al., 2018
myotome has extra parts of type fast muscle cell, abnormal myogkg128/kg128 ; vu119Tg standard conditions Fig. 3 with image from Ganassi et al., 2018
fast muscle cell myoblast fusion decreased occurrence, abnormal myogkg128/kg128 ; vu119Tg standard conditions Fig. 4 with image from Ganassi et al., 2018
myotome fast muscle cell decreased volume, abnormal myogkg128/kg128 ; vu119Tg standard conditions Fig. 3 with image from Ganassi et al., 2018
fast muscle cell nucleus centered, abnormal myogkg128/kg128 ; vu119Tg standard conditions Fig. 4 with image from Ganassi et al., 2018
myotome decreased volume, abnormal myogkg128/kg128 ; vu119Tg standard conditions Fig. 3 with image from Ganassi et al., 2018
Citations