CRISPR

CRISPR2-ar

ID
ZDB-CRISPR-180606-2
Name
CRISPR2-ar
Previous Names
None
Target
Sequence
5' - GGGTACCACTGCTCGTGCGGAGG - 3'
Disclaimer
Although ZFIN verifies reagent sequence data, we recommend that you conduct independent sequence analysis before ordering any reagent.
Note
None
Genome Resources
None
Target Location
Constructs
No data available
Genomic Features
Genomic Feature Affected Genomic Regions
uab105 ar
uab142 ar
Expression
Gene expression in Wild Types + CRISPR2-ar
No data available
Phenotype
Phenotype resulting from CRISPR2-ar
No data available
Phenotype of all Fish created by or utilizing CRISPR2-ar
Phenotype Fish Conditions Figures
male organism development of animal secondary female sexual characteristics increased occurrence, abnormal aruab105/uab105 (AB) standard conditions Fig. 1 from Crowder et al., 2017
female organism oocyte maturation process quality, abnormal aruab105/uab105 (AB) standard conditions Fig. 5 from Crowder et al., 2017
female organism ovary has fewer parts of type oocyte stage III, abnormal aruab105/uab105 (AB) standard conditions Fig. 5 from Crowder et al., 2017
male organism trunk obtuse, abnormal aruab105/uab105 (AB) standard conditions Fig. 1 from Crowder et al., 2017
male sex determination decreased occurrence, abnormal aruab105/uab105 (AB) standard conditions Fig. 2 from Crowder et al., 2017
testis spermatid development delayed, abnormal aruab105/uab105 (AB) standard conditions Fig. 7 from Crowder et al., 2017
male organism development of animal secondary male sexual characteristics decreased occurrence, abnormal aruab105/uab105 (AB) standard conditions Fig. 1 from Crowder et al., 2017
ovary oocyte maturation delayed, abnormal aruab105/uab105 (AB) standard conditions Fig. 7 from Crowder et al., 2017
male organism spermatogenic cyst malformed, abnormal aruab105/uab105 (AB) standard conditions Fig. 4 from Crowder et al., 2017
female sex determination increased occurrence, abnormal aruab105/uab105 (AB) standard conditions Fig. 2 from Crowder et al., 2017
male organism testis foxl2a expression increased amount, abnormal aruab105/uab105 (AB) standard conditions Fig. 8 from Crowder et al., 2017
male organism seminiferous tubule malformed, abnormal aruab105/uab105 (AB) standard conditions Fig. 4 from Crowder et al., 2017
male organism anal fin white, abnormal aruab105/uab105 (AB) standard conditions Fig. 1 from Crowder et al., 2017
male organism testis dmrt1 expression decreased amount, abnormal aruab105/uab105 (AB) standard conditions Fig. 8 from Crowder et al., 2017
female organism ovary cyp19a1a expression decreased amount, abnormal aruab105/uab105 (AB) standard conditions Fig. 8 from Crowder et al., 2017
male organism testis amh expression decreased amount, abnormal aruab105/uab105 (AB) standard conditions Fig. 8 from Crowder et al., 2017
male organism sperm ejaculation arrested, abnormal aruab105/uab105 (AB) standard conditions Fig. 3 from Crowder et al., 2017
male organism spermatogenic cyst disorganized, abnormal aruab105/uab105 (AB) standard conditions Fig. 4 from Crowder et al., 2017
female organism decreased fecundity, abnormal aruab105/uab105 (AB) standard conditions Fig. 5 from Crowder et al., 2017
female organism ovary lacks all parts of type oocyte stage III, abnormal aruab105/uab105 (AB) standard conditions Fig. 7 from Crowder et al., 2017
female organism ovary dmrt1 expression increased amount, abnormal aruab105/uab105 (AB) standard conditions Fig. 8 from Crowder et al., 2017
male organism seminiferous tubule disorganized, abnormal aruab105/uab105 (AB) standard conditions Fig. 4 from Crowder et al., 2017
female organism ovary has extra parts of type oocyte stage I, abnormal aruab105/uab105 (AB) standard conditions Fig. 5 from Crowder et al., 2017
testis lacks all parts of type spermatid, abnormal aruab105/uab105 (AB) standard conditions Fig. 7 from Crowder et al., 2017
female sex determination decreased occurrence, abnormal aruab105/+ (AB) standard conditions Fig. 2 from Crowder et al., 2017
male sex determination increased occurrence, abnormal aruab105/+ (AB) standard conditions Fig. 2 from Crowder et al., 2017
Citations